FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638539_at:

>probe:Drosophila_2:1638539_at:35:509; Interrogation_Position=1010; Antisense; GTGCGTTGCCTCAATGCATGTGGAT
>probe:Drosophila_2:1638539_at:182:571; Interrogation_Position=1057; Antisense; GGCTGTTAACTATTTCTACTTCTTC
>probe:Drosophila_2:1638539_at:437:375; Interrogation_Position=1090; Antisense; GAAGATGCGTCATGTGCCCAAGAAC
>probe:Drosophila_2:1638539_at:685:441; Interrogation_Position=1120; Antisense; GATGAAAGCTTTCTCTCTCAAACCT
>probe:Drosophila_2:1638539_at:195:485; Interrogation_Position=1187; Antisense; GTAGATTTCCGACTTTGCGAACTGT
>probe:Drosophila_2:1638539_at:39:655; Interrogation_Position=732; Antisense; TAATTGGCGACTTTGGTTGCGGCGA
>probe:Drosophila_2:1638539_at:320:235; Interrogation_Position=771; Antisense; AATCCGTGCCCAACAAGGTGTACTC
>probe:Drosophila_2:1638539_at:80:75; Interrogation_Position=786; Antisense; AGGTGTACTCCATGGACTTGGTCGC
>probe:Drosophila_2:1638539_at:236:487; Interrogation_Position=816; Antisense; GTAGCGACATCATTGCCTGCAACAT
>probe:Drosophila_2:1638539_at:684:203; Interrogation_Position=858; Antisense; AAGCTCGAACTCTGGACGTGGCCGT
>probe:Drosophila_2:1638539_at:183:525; Interrogation_Position=901; Antisense; GGGCACGGATCTGAACGAGTTCTTC
>probe:Drosophila_2:1638539_at:630:69; Interrogation_Position=930; Antisense; AGGCCAATCGAGTGCTCAAGCTGCA
>probe:Drosophila_2:1638539_at:436:141; Interrogation_Position=954; Antisense; ACGGCACTGTCTATATCGCGGAGAT
>probe:Drosophila_2:1638539_at:388:463; Interrogation_Position=976; Antisense; GATTCAGTCGCGATTCCAGGATGTG

Paste this into a BLAST search page for me
GTGCGTTGCCTCAATGCATGTGGATGGCTGTTAACTATTTCTACTTCTTCGAAGATGCGTCATGTGCCCAAGAACGATGAAAGCTTTCTCTCTCAAACCTGTAGATTTCCGACTTTGCGAACTGTTAATTGGCGACTTTGGTTGCGGCGAAATCCGTGCCCAACAAGGTGTACTCAGGTGTACTCCATGGACTTGGTCGCGTAGCGACATCATTGCCTGCAACATAAGCTCGAACTCTGGACGTGGCCGTGGGCACGGATCTGAACGAGTTCTTCAGGCCAATCGAGTGCTCAAGCTGCAACGGCACTGTCTATATCGCGGAGATGATTCAGTCGCGATTCCAGGATGTG

Full Affymetrix probeset data:

Annotations for 1638539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720