FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638541_at:

>probe:Drosophila_2:1638541_at:119:675; Interrogation_Position=118; Antisense; TAGCGTTGGCCGGTTTTCAGCATGA
>probe:Drosophila_2:1638541_at:455:477; Interrogation_Position=130; Antisense; GTTTTCAGCATGATCACAGCCCTAA
>probe:Drosophila_2:1638541_at:625:47; Interrogation_Position=155; Antisense; ATCCTCCCAGGAATTCAGTTTGAAG
>probe:Drosophila_2:1638541_at:92:615; Interrogation_Position=175; Antisense; TGAAGCAGCTTATTGGCGACGGATT
>probe:Drosophila_2:1638541_at:434:5; Interrogation_Position=197; Antisense; ATTGCTGTGGGCTGTTCCGAAGCAC
>probe:Drosophila_2:1638541_at:627:551; Interrogation_Position=290; Antisense; GGAGAAGAGAAACCTCCGCTCCTGT
>probe:Drosophila_2:1638541_at:346:369; Interrogation_Position=336; Antisense; GAGATGGGAGTTCTTTGTCCCTTCT
>probe:Drosophila_2:1638541_at:222:687; Interrogation_Position=349; Antisense; TTTGTCCCTTCTGCTACCAAAAGGT
>probe:Drosophila_2:1638541_at:629:105; Interrogation_Position=412; Antisense; AGACACTCGGTCTAGATCCCGTGGA
>probe:Drosophila_2:1638541_at:260:371; Interrogation_Position=467; Antisense; GAAGGCCGAACAGTCCACAGATGAT
>probe:Drosophila_2:1638541_at:584:549; Interrogation_Position=512; Antisense; GGAGATGAAGAAGCCTCGTCCCATG
>probe:Drosophila_2:1638541_at:304:639; Interrogation_Position=527; Antisense; TCGTCCCATGTGGTTCACCAAGAAT
>probe:Drosophila_2:1638541_at:212:281; Interrogation_Position=602; Antisense; CTCCGACTTGGCCTAGATACTAAGC
>probe:Drosophila_2:1638541_at:330:509; Interrogation_Position=634; Antisense; GTGCATTAAATCCACACGTTCGTTA

Paste this into a BLAST search page for me
TAGCGTTGGCCGGTTTTCAGCATGAGTTTTCAGCATGATCACAGCCCTAAATCCTCCCAGGAATTCAGTTTGAAGTGAAGCAGCTTATTGGCGACGGATTATTGCTGTGGGCTGTTCCGAAGCACGGAGAAGAGAAACCTCCGCTCCTGTGAGATGGGAGTTCTTTGTCCCTTCTTTTGTCCCTTCTGCTACCAAAAGGTAGACACTCGGTCTAGATCCCGTGGAGAAGGCCGAACAGTCCACAGATGATGGAGATGAAGAAGCCTCGTCCCATGTCGTCCCATGTGGTTCACCAAGAATCTCCGACTTGGCCTAGATACTAAGCGTGCATTAAATCCACACGTTCGTTA

Full Affymetrix probeset data:

Annotations for 1638541_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720