FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638542_at:

>probe:Drosophila_2:1638542_at:391:569; Interrogation_Position=1061; Antisense; GGCATAAGGTCAAGGGAGCTCCCCA
>probe:Drosophila_2:1638542_at:266:301; Interrogation_Position=1082; Antisense; CCCAGGCATTGGATGTGCGCAACAT
>probe:Drosophila_2:1638542_at:315:281; Interrogation_Position=647; Antisense; CTCGATTTTTCCTAGCCACAATTTT
>probe:Drosophila_2:1638542_at:627:83; Interrogation_Position=703; Antisense; AGTGGTCAACTCAAGTCGATGCTGA
>probe:Drosophila_2:1638542_at:507:27; Interrogation_Position=755; Antisense; ATACGATCGAGAAATGGGCCCAGTC
>probe:Drosophila_2:1638542_at:99:497; Interrogation_Position=792; Antisense; GTCAGCTCCATCCATTATCTGGGTG
>probe:Drosophila_2:1638542_at:616:157; Interrogation_Position=818; Antisense; ACACGGTGCAGAGTTCCGATCTGGA
>probe:Drosophila_2:1638542_at:417:177; Interrogation_Position=842; Antisense; AAACGGAGCAGATCCTGGCCCGGAA
>probe:Drosophila_2:1638542_at:133:301; Interrogation_Position=859; Antisense; GCCCGGAACTTTGAGGTGCACGACT
>probe:Drosophila_2:1638542_at:520:501; Interrogation_Position=894; Antisense; GTCGAATGTCAGTTTCATGCCCAAT
>probe:Drosophila_2:1638542_at:477:43; Interrogation_Position=931; Antisense; ATCGAGCGATTGTCTTCGGGATCTC
>probe:Drosophila_2:1638542_at:726:527; Interrogation_Position=948; Antisense; GGGATCTCTTTCTGTCGGCGATTAT
>probe:Drosophila_2:1638542_at:492:327; Interrogation_Position=965; Antisense; GCGATTATGTATCCACGGAGGCCTT
>probe:Drosophila_2:1638542_at:126:287; Interrogation_Position=980; Antisense; CGGAGGCCTTGGAAAATCGCATTTT

Paste this into a BLAST search page for me
GGCATAAGGTCAAGGGAGCTCCCCACCCAGGCATTGGATGTGCGCAACATCTCGATTTTTCCTAGCCACAATTTTAGTGGTCAACTCAAGTCGATGCTGAATACGATCGAGAAATGGGCCCAGTCGTCAGCTCCATCCATTATCTGGGTGACACGGTGCAGAGTTCCGATCTGGAAAACGGAGCAGATCCTGGCCCGGAAGCCCGGAACTTTGAGGTGCACGACTGTCGAATGTCAGTTTCATGCCCAATATCGAGCGATTGTCTTCGGGATCTCGGGATCTCTTTCTGTCGGCGATTATGCGATTATGTATCCACGGAGGCCTTCGGAGGCCTTGGAAAATCGCATTTT

Full Affymetrix probeset data:

Annotations for 1638542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720