FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638543_at:

>probe:Drosophila_2:1638543_at:159:619; Interrogation_Position=116; Antisense; TGCAGTGCGAATCCTACAATGAGTC
>probe:Drosophila_2:1638543_at:305:583; Interrogation_Position=14; Antisense; TGGCGGAACTTGCATCTAGCAGATT
>probe:Drosophila_2:1638543_at:416:291; Interrogation_Position=187; Antisense; CGTGTGGGAGCCGACATGTATTTAA
>probe:Drosophila_2:1638543_at:447:663; Interrogation_Position=209; Antisense; TAAAGCTGTTTCAAACGCCCGTAGA
>probe:Drosophila_2:1638543_at:682:197; Interrogation_Position=222; Antisense; AACGCCCGTAGAGAACTGTTGGATT
>probe:Drosophila_2:1638543_at:707:455; Interrogation_Position=243; Antisense; GATTAATTGGGCCATGTACCGCCGC
>probe:Drosophila_2:1638543_at:18:487; Interrogation_Position=258; Antisense; GTACCGCCGCTATAATGGCTTTCAG
>probe:Drosophila_2:1638543_at:199:579; Interrogation_Position=273; Antisense; TGGCTTTCAGCCGTTTCTGTACAAT
>probe:Drosophila_2:1638543_at:286:601; Interrogation_Position=290; Antisense; TGTACAATGTCAGCACCGATCTCTG
>probe:Drosophila_2:1638543_at:661:451; Interrogation_Position=307; Antisense; GATCTCTGCCAGCTTTTGGGTAACC
>probe:Drosophila_2:1638543_at:208:531; Interrogation_Position=324; Antisense; GGGTAACCCGAATGCTATATCGTTT
>probe:Drosophila_2:1638543_at:505:251; Interrogation_Position=349; Antisense; CAAGGACTCGTTATTAATGCCATTA
>probe:Drosophila_2:1638543_at:463:465; Interrogation_Position=35; Antisense; GATTGATTCTAGTAACCGCTGCTAT
>probe:Drosophila_2:1638543_at:346:373; Interrogation_Position=96; Antisense; GAAGTCCCGATTTATCAACATGCAG

Paste this into a BLAST search page for me
TGCAGTGCGAATCCTACAATGAGTCTGGCGGAACTTGCATCTAGCAGATTCGTGTGGGAGCCGACATGTATTTAATAAAGCTGTTTCAAACGCCCGTAGAAACGCCCGTAGAGAACTGTTGGATTGATTAATTGGGCCATGTACCGCCGCGTACCGCCGCTATAATGGCTTTCAGTGGCTTTCAGCCGTTTCTGTACAATTGTACAATGTCAGCACCGATCTCTGGATCTCTGCCAGCTTTTGGGTAACCGGGTAACCCGAATGCTATATCGTTTCAAGGACTCGTTATTAATGCCATTAGATTGATTCTAGTAACCGCTGCTATGAAGTCCCGATTTATCAACATGCAG

Full Affymetrix probeset data:

Annotations for 1638543_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720