FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638544_at:

>probe:Drosophila_2:1638544_at:310:89; Interrogation_Position=101; Antisense; AGTCGGTTGGTGATACGGGCTCAAA
>probe:Drosophila_2:1638544_at:452:579; Interrogation_Position=127; Antisense; TGGCGTAACTTTGTCCAGGAGGCAC
>probe:Drosophila_2:1638544_at:488:519; Interrogation_Position=168; Antisense; GTGGCGCTATTGGATACCCTTCGGT
>probe:Drosophila_2:1638544_at:502:589; Interrogation_Position=17; Antisense; TGGATATCGCTGCACAACTCCTTGC
>probe:Drosophila_2:1638544_at:652:275; Interrogation_Position=186; Antisense; CTTCGGTCTCAACCAGTGCGGGAGT
>probe:Drosophila_2:1638544_at:527:549; Interrogation_Position=206; Antisense; GGAGTGCTCTGTACGTTTGGACGCT
>probe:Drosophila_2:1638544_at:39:337; Interrogation_Position=228; Antisense; GCTCCAGAGGGCCAGTATTACAGTG
>probe:Drosophila_2:1638544_at:728:707; Interrogation_Position=245; Antisense; TTACAGTGGCGGTGCCAGTGGCCAA
>probe:Drosophila_2:1638544_at:512:285; Interrogation_Position=274; Antisense; CTGAGCTTCGCATTTACGGCAATCA
>probe:Drosophila_2:1638544_at:475:211; Interrogation_Position=330; Antisense; AAGAAAAGTCATTCTGGGCACCCTG
>probe:Drosophila_2:1638544_at:67:641; Interrogation_Position=359; Antisense; TCTGCTGTGGCAGTATCCTGATGAT
>probe:Drosophila_2:1638544_at:103:659; Interrogation_Position=390; Antisense; TAAGATTTTGCAGGAACAGGCCCAG
>probe:Drosophila_2:1638544_at:300:153; Interrogation_Position=405; Antisense; ACAGGCCCAGCACCAGCTAAATATA
>probe:Drosophila_2:1638544_at:621:471; Interrogation_Position=61; Antisense; GTTACCAATCCGTTTATTCGCCTCG

Paste this into a BLAST search page for me
AGTCGGTTGGTGATACGGGCTCAAATGGCGTAACTTTGTCCAGGAGGCACGTGGCGCTATTGGATACCCTTCGGTTGGATATCGCTGCACAACTCCTTGCCTTCGGTCTCAACCAGTGCGGGAGTGGAGTGCTCTGTACGTTTGGACGCTGCTCCAGAGGGCCAGTATTACAGTGTTACAGTGGCGGTGCCAGTGGCCAACTGAGCTTCGCATTTACGGCAATCAAAGAAAAGTCATTCTGGGCACCCTGTCTGCTGTGGCAGTATCCTGATGATTAAGATTTTGCAGGAACAGGCCCAGACAGGCCCAGCACCAGCTAAATATAGTTACCAATCCGTTTATTCGCCTCG

Full Affymetrix probeset data:

Annotations for 1638544_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720