FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638545_at:

>probe:Drosophila_2:1638545_at:389:713; Interrogation_Position=115; Antisense; TTCACCGAGGAAATGCGCTTAGTAC
>probe:Drosophila_2:1638545_at:102:111; Interrogation_Position=162; Antisense; AGAATGCACAGCAGGTTCTCCAGCT
>probe:Drosophila_2:1638545_at:185:591; Interrogation_Position=186; Antisense; TGGTCATCTCGGACAGCTGTACTGG
>probe:Drosophila_2:1638545_at:271:57; Interrogation_Position=249; Antisense; ATGACCTATGGCCATGTCGCTTGTC
>probe:Drosophila_2:1638545_at:352:381; Interrogation_Position=293; Antisense; GAACGAAATCAACCTGAGTCCCGAC
>probe:Drosophila_2:1638545_at:67:609; Interrogation_Position=307; Antisense; TGAGTCCCGACCAGAGCTGCATGAA
>probe:Drosophila_2:1638545_at:555:613; Interrogation_Position=328; Antisense; TGAACTGCTGCGGAGGCTGCCATGA
>probe:Drosophila_2:1638545_at:546:69; Interrogation_Position=403; Antisense; AGGCCGCTTGCAAGGGAAGGCTCTA
>probe:Drosophila_2:1638545_at:526:665; Interrogation_Position=426; Antisense; TACAAATGCAACACCATCGAGTCCG
>probe:Drosophila_2:1638545_at:648:211; Interrogation_Position=489; Antisense; AAGACCGCTGCTACCAAAGTGTGGA
>probe:Drosophila_2:1638545_at:86:661; Interrogation_Position=569; Antisense; TAACAGCTAACAGTTGGCGCGCAAC
>probe:Drosophila_2:1638545_at:119:583; Interrogation_Position=583; Antisense; TGGCGCGCAACTAACAGCTCTGTTA
>probe:Drosophila_2:1638545_at:159:161; Interrogation_Position=630; Antisense; AAATCCCTAGCGCTTCACCAAAAAT
>probe:Drosophila_2:1638545_at:58:333; Interrogation_Position=664; Antisense; GCGGCTTGATCTCTGTGACATTGAA

Paste this into a BLAST search page for me
TTCACCGAGGAAATGCGCTTAGTACAGAATGCACAGCAGGTTCTCCAGCTTGGTCATCTCGGACAGCTGTACTGGATGACCTATGGCCATGTCGCTTGTCGAACGAAATCAACCTGAGTCCCGACTGAGTCCCGACCAGAGCTGCATGAATGAACTGCTGCGGAGGCTGCCATGAAGGCCGCTTGCAAGGGAAGGCTCTATACAAATGCAACACCATCGAGTCCGAAGACCGCTGCTACCAAAGTGTGGATAACAGCTAACAGTTGGCGCGCAACTGGCGCGCAACTAACAGCTCTGTTAAAATCCCTAGCGCTTCACCAAAAATGCGGCTTGATCTCTGTGACATTGAA

Full Affymetrix probeset data:

Annotations for 1638545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720