FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638546_at:

>probe:Drosophila_2:1638546_at:362:347; Interrogation_Position=143; Antisense; GCATCGGAGGAGTCCAGCAGGTTCC
>probe:Drosophila_2:1638546_at:355:77; Interrogation_Position=150; Antisense; AGGAGTCCAGCAGGTTCCCGTTGTG
>probe:Drosophila_2:1638546_at:5:471; Interrogation_Position=163; Antisense; GTTCCCGTTGTGCAACAAGTGCCCG
>probe:Drosophila_2:1638546_at:305:161; Interrogation_Position=177; Antisense; ACAAGTGCCCGTTGTCCAACAGGTT
>probe:Drosophila_2:1638546_at:557:153; Interrogation_Position=195; Antisense; ACAGGTTCCCGTCGTGCAACAGGTG
>probe:Drosophila_2:1638546_at:510:293; Interrogation_Position=21; Antisense; CGATCTTCAAGTGCATTTTTTGTTA
>probe:Drosophila_2:1638546_at:565:125; Interrogation_Position=236; Antisense; AGCCGCAAGCTCTTGGCCTAGCAGG
>probe:Drosophila_2:1638546_at:687:503; Interrogation_Position=296; Antisense; GTGCCGGTTTTGGACGCTACAAGGA
>probe:Drosophila_2:1638546_at:416:251; Interrogation_Position=315; Antisense; CAAGGAAAGCTATCGCGTGCGAGCG
>probe:Drosophila_2:1638546_at:123:691; Interrogation_Position=39; Antisense; TTTGTTATTACTGGCAATTGGCGCT
>probe:Drosophila_2:1638546_at:322:11; Interrogation_Position=393; Antisense; ATTCGCCGGACTTGGTGCTGCTGGA
>probe:Drosophila_2:1638546_at:347:707; Interrogation_Position=46; Antisense; TTACTGGCAATTGGCGCTTGGCGGA
>probe:Drosophila_2:1638546_at:8:573; Interrogation_Position=58; Antisense; GGCGCTTGGCGGACTGAAGCCCATT
>probe:Drosophila_2:1638546_at:248:301; Interrogation_Position=77; Antisense; CCCATTCCCTGGGAGGAGGTGGAAT

Paste this into a BLAST search page for me
GCATCGGAGGAGTCCAGCAGGTTCCAGGAGTCCAGCAGGTTCCCGTTGTGGTTCCCGTTGTGCAACAAGTGCCCGACAAGTGCCCGTTGTCCAACAGGTTACAGGTTCCCGTCGTGCAACAGGTGCGATCTTCAAGTGCATTTTTTGTTAAGCCGCAAGCTCTTGGCCTAGCAGGGTGCCGGTTTTGGACGCTACAAGGACAAGGAAAGCTATCGCGTGCGAGCGTTTGTTATTACTGGCAATTGGCGCTATTCGCCGGACTTGGTGCTGCTGGATTACTGGCAATTGGCGCTTGGCGGAGGCGCTTGGCGGACTGAAGCCCATTCCCATTCCCTGGGAGGAGGTGGAAT

Full Affymetrix probeset data:

Annotations for 1638546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720