FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638549_at:

>probe:Drosophila_2:1638549_at:9:419; Interrogation_Position=103; Antisense; GAGCATTGTTTTGTTCGGCACACTG
>probe:Drosophila_2:1638549_at:537:357; Interrogation_Position=120; Antisense; GCACACTGCGTTTCTGCTCAGAATG
>probe:Drosophila_2:1638549_at:83:371; Interrogation_Position=140; Antisense; GAATGGTTTAACGACTCGCAGCTGA
>probe:Drosophila_2:1638549_at:466:605; Interrogation_Position=162; Antisense; TGAGGGTCCTTTTGGGCGGATACCT
>probe:Drosophila_2:1638549_at:372:457; Interrogation_Position=180; Antisense; GATACCTCTTCTCCTGGGTGTTCAT
>probe:Drosophila_2:1638549_at:48:99; Interrogation_Position=234; Antisense; AGATGGTTGTTTTCGGCCAGGACTT
>probe:Drosophila_2:1638549_at:364:269; Interrogation_Position=260; Antisense; CAGGCCAAGCTGCTACCAGAGATTA
>probe:Drosophila_2:1638549_at:525:171; Interrogation_Position=36; Antisense; AAAGTAATATGTCCGCTTCAGTGAG
>probe:Drosophila_2:1638549_at:133:525; Interrogation_Position=368; Antisense; GGGCTCTACTTCCTTAACAGGATCT
>probe:Drosophila_2:1638549_at:160:189; Interrogation_Position=383; Antisense; AACAGGATCTCCACGAAGTATTACT
>probe:Drosophila_2:1638549_at:316:217; Interrogation_Position=398; Antisense; AAGTATTACTCCGTTCAGGTGCCCA
>probe:Drosophila_2:1638549_at:710:121; Interrogation_Position=422; Antisense; AGCGTGGATGCTCCTACGACGAGAA
>probe:Drosophila_2:1638549_at:161:231; Interrogation_Position=465; Antisense; AATGAACCATTCGTCTGCTTCTTAT
>probe:Drosophila_2:1638549_at:673:491; Interrogation_Position=63; Antisense; GTAAGAGCACCGTGGTATCCTCCAT

Paste this into a BLAST search page for me
GAGCATTGTTTTGTTCGGCACACTGGCACACTGCGTTTCTGCTCAGAATGGAATGGTTTAACGACTCGCAGCTGATGAGGGTCCTTTTGGGCGGATACCTGATACCTCTTCTCCTGGGTGTTCATAGATGGTTGTTTTCGGCCAGGACTTCAGGCCAAGCTGCTACCAGAGATTAAAAGTAATATGTCCGCTTCAGTGAGGGGCTCTACTTCCTTAACAGGATCTAACAGGATCTCCACGAAGTATTACTAAGTATTACTCCGTTCAGGTGCCCAAGCGTGGATGCTCCTACGACGAGAAAATGAACCATTCGTCTGCTTCTTATGTAAGAGCACCGTGGTATCCTCCAT

Full Affymetrix probeset data:

Annotations for 1638549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720