FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638551_at:

>probe:Drosophila_2:1638551_at:216:255; Interrogation_Position=114; Antisense; CCGTACCTTCAACCTAATCCAAGAG
>probe:Drosophila_2:1638551_at:510:61; Interrogation_Position=13; Antisense; ATGTCTGCCTTTAAAATTGCTTATG
>probe:Drosophila_2:1638551_at:441:9; Interrogation_Position=168; Antisense; ATTCCAGAATCTGCACTGCTCCAAG
>probe:Drosophila_2:1638551_at:133:311; Interrogation_Position=188; Antisense; CCAAGTGCCGCATGGAACTGGGTCT
>probe:Drosophila_2:1638551_at:380:195; Interrogation_Position=203; Antisense; AACTGGGTCTGCTGTGCTTGCAGAG
>probe:Drosophila_2:1638551_at:49:627; Interrogation_Position=239; Antisense; TCCAACTGAAGGGACTTTCGCTGTT
>probe:Drosophila_2:1638551_at:670:275; Interrogation_Position=253; Antisense; CTTTCGCTGTTGGAGAAGGTTCATC
>probe:Drosophila_2:1638551_at:553:77; Interrogation_Position=269; Antisense; AGGTTCATCTGGTGGTGTACGACTC
>probe:Drosophila_2:1638551_at:36:3; Interrogation_Position=28; Antisense; ATTGCTTATGCCTGTCGTTATTGTG
>probe:Drosophila_2:1638551_at:333:405; Interrogation_Position=289; Antisense; GACTCGTACGAGGTGCCATTCGAGA
>probe:Drosophila_2:1638551_at:684:9; Interrogation_Position=306; Antisense; ATTCGAGATGGCCTCACTTCGTGAC
>probe:Drosophila_2:1638551_at:383:691; Interrogation_Position=46; Antisense; TATTGTGGCAATATCGTCAGCTACA
>probe:Drosophila_2:1638551_at:301:637; Interrogation_Position=59; Antisense; TCGTCAGCTACAAGTCAGCCAAAGT
>probe:Drosophila_2:1638551_at:78:161; Interrogation_Position=79; Antisense; AAAGTGAATGAGACGCCCTACGACT

Paste this into a BLAST search page for me
CCGTACCTTCAACCTAATCCAAGAGATGTCTGCCTTTAAAATTGCTTATGATTCCAGAATCTGCACTGCTCCAAGCCAAGTGCCGCATGGAACTGGGTCTAACTGGGTCTGCTGTGCTTGCAGAGTCCAACTGAAGGGACTTTCGCTGTTCTTTCGCTGTTGGAGAAGGTTCATCAGGTTCATCTGGTGGTGTACGACTCATTGCTTATGCCTGTCGTTATTGTGGACTCGTACGAGGTGCCATTCGAGAATTCGAGATGGCCTCACTTCGTGACTATTGTGGCAATATCGTCAGCTACATCGTCAGCTACAAGTCAGCCAAAGTAAAGTGAATGAGACGCCCTACGACT

Full Affymetrix probeset data:

Annotations for 1638551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720