FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638552_at:

>probe:Drosophila_2:1638552_at:606:593; Interrogation_Position=1002; Antisense; TGTGTATGCAAACTTGACAGGCTGA
>probe:Drosophila_2:1638552_at:331:523; Interrogation_Position=673; Antisense; GGGCCAATCGAAACGTGTACACTTC
>probe:Drosophila_2:1638552_at:529:389; Interrogation_Position=682; Antisense; GAAACGTGTACACTTCAGGTCAGAA
>probe:Drosophila_2:1638552_at:330:463; Interrogation_Position=707; Antisense; GATTCGAAGGCTACGAACCCTTGTC
>probe:Drosophila_2:1638552_at:447:295; Interrogation_Position=720; Antisense; CGAACCCTTGTCACACATCAGAAAT
>probe:Drosophila_2:1638552_at:499:171; Interrogation_Position=755; Antisense; AAAGACGTTATCCTTGGCAGCACAC
>probe:Drosophila_2:1638552_at:60:111; Interrogation_Position=773; Antisense; AGCACACTCGGCCAGTTGAAAATTG
>probe:Drosophila_2:1638552_at:588:657; Interrogation_Position=800; Antisense; TAAGCCATGTTTGTGGGTTTTTCGG
>probe:Drosophila_2:1638552_at:309:713; Interrogation_Position=820; Antisense; TTCGGTTTCGTTCCTGTTCGGTGCA
>probe:Drosophila_2:1638552_at:289:471; Interrogation_Position=835; Antisense; GTTCGGTGCATTTTTATCGCATTTA
>probe:Drosophila_2:1638552_at:67:207; Interrogation_Position=885; Antisense; AAGCTTCTGTGAGTCCGGGAATATG
>probe:Drosophila_2:1638552_at:252:501; Interrogation_Position=897; Antisense; GTCCGGGAATATGAACGAGAGCTTT
>probe:Drosophila_2:1638552_at:237:479; Interrogation_Position=940; Antisense; GTTTACACGCATGCTGAAGCTGCCT
>probe:Drosophila_2:1638552_at:631:127; Interrogation_Position=987; Antisense; ACCACTACCACTGTCTGTGTATGCA

Paste this into a BLAST search page for me
TGTGTATGCAAACTTGACAGGCTGAGGGCCAATCGAAACGTGTACACTTCGAAACGTGTACACTTCAGGTCAGAAGATTCGAAGGCTACGAACCCTTGTCCGAACCCTTGTCACACATCAGAAATAAAGACGTTATCCTTGGCAGCACACAGCACACTCGGCCAGTTGAAAATTGTAAGCCATGTTTGTGGGTTTTTCGGTTCGGTTTCGTTCCTGTTCGGTGCAGTTCGGTGCATTTTTATCGCATTTAAAGCTTCTGTGAGTCCGGGAATATGGTCCGGGAATATGAACGAGAGCTTTGTTTACACGCATGCTGAAGCTGCCTACCACTACCACTGTCTGTGTATGCA

Full Affymetrix probeset data:

Annotations for 1638552_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720