FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638554_at:

>probe:Drosophila_2:1638554_at:686:279; Interrogation_Position=1032; Antisense; CTCTGTTCTGTCTCATCAACTAGTT
>probe:Drosophila_2:1638554_at:76:391; Interrogation_Position=539; Antisense; GAAACTGGCACCAACCACTGAGAGG
>probe:Drosophila_2:1638554_at:684:551; Interrogation_Position=644; Antisense; GGAGAATTGTCTCGCCCTGCTGAAT
>probe:Drosophila_2:1638554_at:596:365; Interrogation_Position=665; Antisense; GAATCAGTTCTACAACGATGGCGTA
>probe:Drosophila_2:1638554_at:108:567; Interrogation_Position=694; Antisense; GGCACGATGTGGCATGCCATCACAA
>probe:Drosophila_2:1638554_at:425:107; Interrogation_Position=718; Antisense; AGAAGAGCTTCGTCTGCGAGGAGAA
>probe:Drosophila_2:1638554_at:712:551; Interrogation_Position=737; Antisense; GGAGAACGATGCTCTGCTGAAGTAT
>probe:Drosophila_2:1638554_at:573:373; Interrogation_Position=755; Antisense; GAAGTATGTGCGCTACACGAACCCC
>probe:Drosophila_2:1638554_at:230:379; Interrogation_Position=773; Antisense; GAACCCCAATCTGCGCATCTAAGAG
>probe:Drosophila_2:1638554_at:282:415; Interrogation_Position=846; Antisense; GACCAGCGACACTCTCCAAGTAAAA
>probe:Drosophila_2:1638554_at:417:605; Interrogation_Position=878; Antisense; TGATATTTCCCAAATCGGCAGCGGG
>probe:Drosophila_2:1638554_at:546:655; Interrogation_Position=930; Antisense; TAATCTCCGATTGTCTTTGAATGCA
>probe:Drosophila_2:1638554_at:621:367; Interrogation_Position=948; Antisense; GAATGCAAAGTTTTCTGGCCAAATT
>probe:Drosophila_2:1638554_at:508:681; Interrogation_Position=991; Antisense; TTATGAACCCTATCCTGGTAACCAC

Paste this into a BLAST search page for me
CTCTGTTCTGTCTCATCAACTAGTTGAAACTGGCACCAACCACTGAGAGGGGAGAATTGTCTCGCCCTGCTGAATGAATCAGTTCTACAACGATGGCGTAGGCACGATGTGGCATGCCATCACAAAGAAGAGCTTCGTCTGCGAGGAGAAGGAGAACGATGCTCTGCTGAAGTATGAAGTATGTGCGCTACACGAACCCCGAACCCCAATCTGCGCATCTAAGAGGACCAGCGACACTCTCCAAGTAAAATGATATTTCCCAAATCGGCAGCGGGTAATCTCCGATTGTCTTTGAATGCAGAATGCAAAGTTTTCTGGCCAAATTTTATGAACCCTATCCTGGTAACCAC

Full Affymetrix probeset data:

Annotations for 1638554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720