FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638557_at:

>probe:Drosophila_2:1638557_at:513:47; Interrogation_Position=118; Antisense; ATCCTGCTCGCAATTGCTTCTAATG
>probe:Drosophila_2:1638557_at:319:435; Interrogation_Position=262; Antisense; GAGGTAATATCGCTGCTGGGCATAA
>probe:Drosophila_2:1638557_at:329:65; Interrogation_Position=290; Antisense; ATGGTGCTGAGTCCGATATCCTGGT
>probe:Drosophila_2:1638557_at:127:411; Interrogation_Position=325; Antisense; GACGACAAGTGTCCTGGCGGCTATT
>probe:Drosophila_2:1638557_at:160:575; Interrogation_Position=340; Antisense; GGCGGCTATTTCCACTGCAATACAA
>probe:Drosophila_2:1638557_at:249:197; Interrogation_Position=363; Antisense; AACGGCACAGTGTGTTCCACAGCGG
>probe:Drosophila_2:1638557_at:535:349; Interrogation_Position=401; Antisense; GCAGTGTCGACTGCGATGACGCATC
>probe:Drosophila_2:1638557_at:262:393; Interrogation_Position=482; Antisense; GAAAGCAGCCATTCGGGAGACACGA
>probe:Drosophila_2:1638557_at:363:77; Interrogation_Position=514; Antisense; AGGATTGGCGAATGCCTTTGGCCCA
>probe:Drosophila_2:1638557_at:633:631; Interrogation_Position=550; Antisense; TCCTGTCCCTGTCGAGGTGATGAAA
>probe:Drosophila_2:1638557_at:371:697; Interrogation_Position=586; Antisense; TTTCAGCAGCTAACCGATATTCCAG
>probe:Drosophila_2:1638557_at:250:17; Interrogation_Position=59; Antisense; ATTTCATCGCCATTGGGCCACAAAT
>probe:Drosophila_2:1638557_at:538:459; Interrogation_Position=601; Antisense; GATATTCCAGAACGACTGCCGCAGC
>probe:Drosophila_2:1638557_at:16:729; Interrogation_Position=71; Antisense; TTGGGCCACAAATGTACTCTCACCT

Paste this into a BLAST search page for me
ATCCTGCTCGCAATTGCTTCTAATGGAGGTAATATCGCTGCTGGGCATAAATGGTGCTGAGTCCGATATCCTGGTGACGACAAGTGTCCTGGCGGCTATTGGCGGCTATTTCCACTGCAATACAAAACGGCACAGTGTGTTCCACAGCGGGCAGTGTCGACTGCGATGACGCATCGAAAGCAGCCATTCGGGAGACACGAAGGATTGGCGAATGCCTTTGGCCCATCCTGTCCCTGTCGAGGTGATGAAATTTCAGCAGCTAACCGATATTCCAGATTTCATCGCCATTGGGCCACAAATGATATTCCAGAACGACTGCCGCAGCTTGGGCCACAAATGTACTCTCACCT

Full Affymetrix probeset data:

Annotations for 1638557_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720