FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638559_at:

>probe:Drosophila_2:1638559_at:628:559; Interrogation_Position=115; Antisense; GGAATACCCGGAACCATTAATCATC
>probe:Drosophila_2:1638559_at:349:655; Interrogation_Position=132; Antisense; TAATCATCCGAGTCCAGATCCAAGT
>probe:Drosophila_2:1638559_at:687:573; Interrogation_Position=177; Antisense; GGCGGCATTGCAATTGGTGGACATT
>probe:Drosophila_2:1638559_at:242:585; Interrogation_Position=208; Antisense; TGGAAGAAACTTTTGCGCTGCGCTC
>probe:Drosophila_2:1638559_at:337:311; Interrogation_Position=235; Antisense; GCCACGTGTCCTTGCGTTTTGGTTA
>probe:Drosophila_2:1638559_at:189:297; Interrogation_Position=248; Antisense; GCGTTTTGGTTAGCTTCCTGCGATT
>probe:Drosophila_2:1638559_at:266:587; Interrogation_Position=263; Antisense; TCCTGCGATTTTGCTCGGAACGAGT
>probe:Drosophila_2:1638559_at:86:199; Interrogation_Position=281; Antisense; AACGAGTGGCACGTGCTAATCGGCG
>probe:Drosophila_2:1638559_at:610:283; Interrogation_Position=32; Antisense; CTGACCGCCGCCTACTAGGAAAAAT
>probe:Drosophila_2:1638559_at:9:303; Interrogation_Position=339; Antisense; CCCTGGACATCCTTTGCTTAATGAG
>probe:Drosophila_2:1638559_at:246:709; Interrogation_Position=356; Antisense; TTAATGAGTGCACTCATGCCCACAC
>probe:Drosophila_2:1638559_at:319:201; Interrogation_Position=389; Antisense; AACCGAATGAGTGTCGCCCTGCGGA
>probe:Drosophila_2:1638559_at:48:45; Interrogation_Position=58; Antisense; ATCCCCAGCCGATTTGAACGATTTA
>probe:Drosophila_2:1638559_at:177:197; Interrogation_Position=74; Antisense; AACGATTTATTATTTGGCCCAGCCA

Paste this into a BLAST search page for me
GGAATACCCGGAACCATTAATCATCTAATCATCCGAGTCCAGATCCAAGTGGCGGCATTGCAATTGGTGGACATTTGGAAGAAACTTTTGCGCTGCGCTCGCCACGTGTCCTTGCGTTTTGGTTAGCGTTTTGGTTAGCTTCCTGCGATTTCCTGCGATTTTGCTCGGAACGAGTAACGAGTGGCACGTGCTAATCGGCGCTGACCGCCGCCTACTAGGAAAAATCCCTGGACATCCTTTGCTTAATGAGTTAATGAGTGCACTCATGCCCACACAACCGAATGAGTGTCGCCCTGCGGAATCCCCAGCCGATTTGAACGATTTAAACGATTTATTATTTGGCCCAGCCA

Full Affymetrix probeset data:

Annotations for 1638559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720