FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638563_at:

>probe:Drosophila_2:1638563_at:611:703; Interrogation_Position=6281; Antisense; TTATCTTTGGCGAAACTGCTGCTCT
>probe:Drosophila_2:1638563_at:87:677; Interrogation_Position=6308; Antisense; TAGCACACTCTCTACTAAGTCTACG
>probe:Drosophila_2:1638563_at:628:677; Interrogation_Position=6381; Antisense; TAGTTCGCATTTAAGTCCACATTTT
>probe:Drosophila_2:1638563_at:44:505; Interrogation_Position=6395; Antisense; GTCCACATTTTGTATACCTCATTAG
>probe:Drosophila_2:1638563_at:441:153; Interrogation_Position=6448; Antisense; ACATGTAAAGGCTTGGTTTCTTCGT
>probe:Drosophila_2:1638563_at:319:539; Interrogation_Position=6462; Antisense; GGTTTCTTCGTTTTACAATCAGAGC
>probe:Drosophila_2:1638563_at:623:191; Interrogation_Position=6598; Antisense; AACTAAGCTGCCAACGATTCGTGTT
>probe:Drosophila_2:1638563_at:352:695; Interrogation_Position=6628; Antisense; TTTCGATGCAAGTTAATTGGCCACT
>probe:Drosophila_2:1638563_at:406:653; Interrogation_Position=6641; Antisense; TAATTGGCCACTAACAACCAACCAG
>probe:Drosophila_2:1638563_at:397:201; Interrogation_Position=6660; Antisense; AACCAGGCCAACAAACAGGACACTG
>probe:Drosophila_2:1638563_at:41:555; Interrogation_Position=6677; Antisense; GGACACTGAATATTGGCACGGCTAA
>probe:Drosophila_2:1638563_at:79:729; Interrogation_Position=6689; Antisense; TTGGCACGGCTAAAGAGTCTAAGAT
>probe:Drosophila_2:1638563_at:373:379; Interrogation_Position=6724; Antisense; GAAGCGCGGTGTTTGTTTAGAGAAT
>probe:Drosophila_2:1638563_at:186:369; Interrogation_Position=6768; Antisense; GAATGAACGCAACCTTAACTATTGG

Paste this into a BLAST search page for me
TTATCTTTGGCGAAACTGCTGCTCTTAGCACACTCTCTACTAAGTCTACGTAGTTCGCATTTAAGTCCACATTTTGTCCACATTTTGTATACCTCATTAGACATGTAAAGGCTTGGTTTCTTCGTGGTTTCTTCGTTTTACAATCAGAGCAACTAAGCTGCCAACGATTCGTGTTTTTCGATGCAAGTTAATTGGCCACTTAATTGGCCACTAACAACCAACCAGAACCAGGCCAACAAACAGGACACTGGGACACTGAATATTGGCACGGCTAATTGGCACGGCTAAAGAGTCTAAGATGAAGCGCGGTGTTTGTTTAGAGAATGAATGAACGCAACCTTAACTATTGG

Full Affymetrix probeset data:

Annotations for 1638563_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720