FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638564_at:

>probe:Drosophila_2:1638564_at:310:557; Interrogation_Position=103; Antisense; GGACATTCCAAACCACCCGGAGAAG
>probe:Drosophila_2:1638564_at:621:421; Interrogation_Position=122; Antisense; GAGAAGTACCTGTTCGATGTGCGCA
>probe:Drosophila_2:1638564_at:282:63; Interrogation_Position=138; Antisense; ATGTGCGCAACGAGTCGGAGCTGAA
>probe:Drosophila_2:1638564_at:557:345; Interrogation_Position=186; Antisense; GCATAAACATTCCACTGAGCGAGCT
>probe:Drosophila_2:1638564_at:622:437; Interrogation_Position=236; Antisense; GAGGACTTCGCCCAGACTTATGGAC
>probe:Drosophila_2:1638564_at:8:53; Interrogation_Position=279; Antisense; ATGCGGTCTTGATCTTCTCGTGCAA
>probe:Drosophila_2:1638564_at:402:199; Interrogation_Position=359; Antisense; AACGCCAAGGCTTATGCCGGATCAT
>probe:Drosophila_2:1638564_at:84:521; Interrogation_Position=391; Antisense; GTGGCAGGCCAAGCAGTCCTAAAAC
>probe:Drosophila_2:1638564_at:197:117; Interrogation_Position=512; Antisense; AGCTTCACCTTGAGTGGCACGCTGA
>probe:Drosophila_2:1638564_at:562:567; Interrogation_Position=527; Antisense; GGCACGCTGAGTTTCACGCAGTTCT
>probe:Drosophila_2:1638564_at:462:135; Interrogation_Position=542; Antisense; ACGCAGTTCTCCATGGTGAGGCTAA
>probe:Drosophila_2:1638564_at:402:437; Interrogation_Position=559; Antisense; GAGGCTAAGGACTTTGGCTATTTTT
>probe:Drosophila_2:1638564_at:658:1; Interrogation_Position=590; Antisense; TTTCCCGTTGGCACCTCGAAAATGA
>probe:Drosophila_2:1638564_at:401:241; Interrogation_Position=77; Antisense; AATATGGCCACCTACGAGGAAGTCA

Paste this into a BLAST search page for me
GGACATTCCAAACCACCCGGAGAAGGAGAAGTACCTGTTCGATGTGCGCAATGTGCGCAACGAGTCGGAGCTGAAGCATAAACATTCCACTGAGCGAGCTGAGGACTTCGCCCAGACTTATGGACATGCGGTCTTGATCTTCTCGTGCAAAACGCCAAGGCTTATGCCGGATCATGTGGCAGGCCAAGCAGTCCTAAAACAGCTTCACCTTGAGTGGCACGCTGAGGCACGCTGAGTTTCACGCAGTTCTACGCAGTTCTCCATGGTGAGGCTAAGAGGCTAAGGACTTTGGCTATTTTTTTTCCCGTTGGCACCTCGAAAATGAAATATGGCCACCTACGAGGAAGTCA

Full Affymetrix probeset data:

Annotations for 1638564_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720