FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638565_at:

>probe:Drosophila_2:1638565_at:702:401; Interrogation_Position=1022; Antisense; GACTTCCGCTGCCACAGATGCAGAT
>probe:Drosophila_2:1638565_at:545:97; Interrogation_Position=1037; Antisense; AGATGCAGATGCCATTCCCGTACTT
>probe:Drosophila_2:1638565_at:66:667; Interrogation_Position=1057; Antisense; TACTTCTACCCGCAACACAAGGTGC
>probe:Drosophila_2:1638565_at:545:127; Interrogation_Position=1098; Antisense; ACCAACCCAGAGTTCCAGCTTTGTG
>probe:Drosophila_2:1638565_at:571:117; Interrogation_Position=1114; Antisense; AGCTTTGTGACTGCATCCTCGGCGT
>probe:Drosophila_2:1638565_at:150:503; Interrogation_Position=1196; Antisense; GTCCCAGTCCCAATGGCCAGATGAT
>probe:Drosophila_2:1638565_at:643:147; Interrogation_Position=1289; Antisense; ACTAGGTTGGGAGTGACCATGTCTC
>probe:Drosophila_2:1638565_at:9:513; Interrogation_Position=1357; Antisense; GTGTTTTAGCCTCTATGTGTAACCA
>probe:Drosophila_2:1638565_at:38:679; Interrogation_Position=1383; Antisense; TAGATGTCCCATAGCTTTAGTAGCA
>probe:Drosophila_2:1638565_at:727:485; Interrogation_Position=1415; Antisense; GTAGTCGTATCTACCCGAGAGCTAA
>probe:Drosophila_2:1638565_at:596:69; Interrogation_Position=860; Antisense; AGGCCGCCCTTTTGGGTGCCAGCAA
>probe:Drosophila_2:1638565_at:647:533; Interrogation_Position=874; Antisense; GGTGCCAGCAAGAGGGTTCCCGTCC
>probe:Drosophila_2:1638565_at:95:719; Interrogation_Position=890; Antisense; TTCCCGTCCAAGTCTTGGTGCGAGA
>probe:Drosophila_2:1638565_at:34:649; Interrogation_Position=999; Antisense; TCAGCTGCAGCTGGCCTACGGCGGA

Paste this into a BLAST search page for me
GACTTCCGCTGCCACAGATGCAGATAGATGCAGATGCCATTCCCGTACTTTACTTCTACCCGCAACACAAGGTGCACCAACCCAGAGTTCCAGCTTTGTGAGCTTTGTGACTGCATCCTCGGCGTGTCCCAGTCCCAATGGCCAGATGATACTAGGTTGGGAGTGACCATGTCTCGTGTTTTAGCCTCTATGTGTAACCATAGATGTCCCATAGCTTTAGTAGCAGTAGTCGTATCTACCCGAGAGCTAAAGGCCGCCCTTTTGGGTGCCAGCAAGGTGCCAGCAAGAGGGTTCCCGTCCTTCCCGTCCAAGTCTTGGTGCGAGATCAGCTGCAGCTGGCCTACGGCGGA

Full Affymetrix probeset data:

Annotations for 1638565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720