FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638567_at:

>probe:Drosophila_2:1638567_at:6:665; Interrogation_Position=1056; Antisense; TACTCTTTACGCTCAGAACTTCTGT
>probe:Drosophila_2:1638567_at:378:545; Interrogation_Position=1092; Antisense; GGATCTGGCCGAGCATGTCTTCTAT
>probe:Drosophila_2:1638567_at:419:263; Interrogation_Position=1105; Antisense; CATGTCTTCTATCTGGGCCTTAAAC
>probe:Drosophila_2:1638567_at:74:387; Interrogation_Position=1131; Antisense; GAACAAGGACTTTTACGACATATAC
>probe:Drosophila_2:1638567_at:664:295; Interrogation_Position=1146; Antisense; CGACATATACTCTTGTGGATTCCAA
>probe:Drosophila_2:1638567_at:237:455; Interrogation_Position=1200; Antisense; GATCAAGACCATTTCTACCATATAT
>probe:Drosophila_2:1638567_at:683:423; Interrogation_Position=1369; Antisense; GAGAAATTTCTTCCATATCGATTGA
>probe:Drosophila_2:1638567_at:53:605; Interrogation_Position=831; Antisense; TGATTTCACGCGGTTTCGCGAAGAT
>probe:Drosophila_2:1638567_at:613:63; Interrogation_Position=854; Antisense; ATGTGGAGTGTTTAAGGCTGCCGCA
>probe:Drosophila_2:1638567_at:345:71; Interrogation_Position=868; Antisense; AGGCTGCCGCAGTTCGTTAATGTTC
>probe:Drosophila_2:1638567_at:430:369; Interrogation_Position=905; Antisense; GAATGCTGGCTGTGATCTACTTAAA
>probe:Drosophila_2:1638567_at:62:667; Interrogation_Position=922; Antisense; TACTTAAAGAGCTTCCGAGCGGCCT
>probe:Drosophila_2:1638567_at:609:709; Interrogation_Position=934; Antisense; TTCCGAGCGGCCTGGATAGACTACA
>probe:Drosophila_2:1638567_at:681:191; Interrogation_Position=970; Antisense; AACTCGCCTCCACAGAACAGTGGGA

Paste this into a BLAST search page for me
TACTCTTTACGCTCAGAACTTCTGTGGATCTGGCCGAGCATGTCTTCTATCATGTCTTCTATCTGGGCCTTAAACGAACAAGGACTTTTACGACATATACCGACATATACTCTTGTGGATTCCAAGATCAAGACCATTTCTACCATATATGAGAAATTTCTTCCATATCGATTGATGATTTCACGCGGTTTCGCGAAGATATGTGGAGTGTTTAAGGCTGCCGCAAGGCTGCCGCAGTTCGTTAATGTTCGAATGCTGGCTGTGATCTACTTAAATACTTAAAGAGCTTCCGAGCGGCCTTTCCGAGCGGCCTGGATAGACTACAAACTCGCCTCCACAGAACAGTGGGA

Full Affymetrix probeset data:

Annotations for 1638567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720