Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638568_s_at:

>probe:Drosophila_2:1638568_s_at:535:117; Interrogation_Position=3348; Antisense; AGCTCCTCCGCAATGTTTCATACTA
>probe:Drosophila_2:1638568_s_at:408:103; Interrogation_Position=3398; Antisense; AGACTTACCACTGAATCTGTCAAAG
>probe:Drosophila_2:1638568_s_at:301:173; Interrogation_Position=3419; Antisense; AAAGCACTGAGACATACACACGCCC
>probe:Drosophila_2:1638568_s_at:123:697; Interrogation_Position=3456; Antisense; TTTCTGGGCCAACCATTCGAGTTAA
>probe:Drosophila_2:1638568_s_at:68:385; Interrogation_Position=3481; Antisense; GAACATTTTCGCACTAGTAGCGCTT
>probe:Drosophila_2:1638568_s_at:122:487; Interrogation_Position=3497; Antisense; GTAGCGCTTAAGACGACATTCAATA
>probe:Drosophila_2:1638568_s_at:23:335; Interrogation_Position=3546; Antisense; GCTGATAGTTTAGTTGTAACCCGAT
>probe:Drosophila_2:1638568_s_at:352:599; Interrogation_Position=3560; Antisense; TGTAACCCGATTGTTTAATCCTAAG
>probe:Drosophila_2:1638568_s_at:639:203; Interrogation_Position=3582; Antisense; AAGCCTAATCCTAGGTTCTCAATTA
>probe:Drosophila_2:1638568_s_at:644:679; Interrogation_Position=3593; Antisense; TAGGTTCTCAATTAGGGCCGAACAT
>probe:Drosophila_2:1638568_s_at:478:523; Interrogation_Position=3607; Antisense; GGGCCGAACATTTAGAAATCGCATA
>probe:Drosophila_2:1638568_s_at:572:469; Interrogation_Position=3670; Antisense; GTTCCAGAACTCTTTATACAATCAG
>probe:Drosophila_2:1638568_s_at:353:565; Interrogation_Position=3737; Antisense; GGAATTTTATTCTATGCCGACTAAT
>probe:Drosophila_2:1638568_s_at:677:271; Interrogation_Position=3855; Antisense; CATTTCCTTGAAACAGACTGAACCT

Paste this into a BLAST search page for me
AGCTCCTCCGCAATGTTTCATACTAAGACTTACCACTGAATCTGTCAAAGAAAGCACTGAGACATACACACGCCCTTTCTGGGCCAACCATTCGAGTTAAGAACATTTTCGCACTAGTAGCGCTTGTAGCGCTTAAGACGACATTCAATAGCTGATAGTTTAGTTGTAACCCGATTGTAACCCGATTGTTTAATCCTAAGAAGCCTAATCCTAGGTTCTCAATTATAGGTTCTCAATTAGGGCCGAACATGGGCCGAACATTTAGAAATCGCATAGTTCCAGAACTCTTTATACAATCAGGGAATTTTATTCTATGCCGACTAATCATTTCCTTGAAACAGACTGAACCT

Full Affymetrix probeset data:

Annotations for 1638568_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime