Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638571_at:

>probe:Drosophila_2:1638571_at:120:97; Interrogation_Position=152; Antisense; AGATACCTCTATCATGTTGCGAAAG
>probe:Drosophila_2:1638571_at:122:653; Interrogation_Position=233; Antisense; TCAACATCGGTGTCCTTCGATTGTT
>probe:Drosophila_2:1638571_at:469:57; Interrogation_Position=277; Antisense; ATGATCGTTTTCTTCGGATGGCCAA
>probe:Drosophila_2:1638571_at:576:547; Interrogation_Position=292; Antisense; GGATGGCCAAGCAATCTTTTGATTT
>probe:Drosophila_2:1638571_at:497:661; Interrogation_Position=317; Antisense; TAAAGGACTTCAATTCGCGGCGCTT
>probe:Drosophila_2:1638571_at:172:125; Interrogation_Position=345; Antisense; AGCCCTCACACACTTTTTACTGGTG
>probe:Drosophila_2:1638571_at:79:145; Interrogation_Position=392; Antisense; ACTCCATTGTATTTATCACTCCGCA
>probe:Drosophila_2:1638571_at:436:31; Interrogation_Position=422; Antisense; ATAATATCTTCGTTCCGCTTTTTGC
>probe:Drosophila_2:1638571_at:653:295; Interrogation_Position=493; Antisense; CGACGTGGATTGATGCCTCTGGAGC
>probe:Drosophila_2:1638571_at:188:275; Interrogation_Position=552; Antisense; CTTGTGCTGTGTTGTTGCCGGGCAA
>probe:Drosophila_2:1638571_at:276:305; Interrogation_Position=569; Antisense; CCGGGCAATGGCTGCTCAAGTATTT
>probe:Drosophila_2:1638571_at:581:403; Interrogation_Position=594; Antisense; GATCTTTCATTAGCGTACGGATTTC
>probe:Drosophila_2:1638571_at:115:275; Interrogation_Position=618; Antisense; CATTGTAATGTTTTGTTCGCCTTAT
>probe:Drosophila_2:1638571_at:98:569; Interrogation_Position=91; Antisense; GGCATGACATTCTTCGAGCAGATCA

Paste this into a BLAST search page for me
AGATACCTCTATCATGTTGCGAAAGTCAACATCGGTGTCCTTCGATTGTTATGATCGTTTTCTTCGGATGGCCAAGGATGGCCAAGCAATCTTTTGATTTTAAAGGACTTCAATTCGCGGCGCTTAGCCCTCACACACTTTTTACTGGTGACTCCATTGTATTTATCACTCCGCAATAATATCTTCGTTCCGCTTTTTGCCGACGTGGATTGATGCCTCTGGAGCCTTGTGCTGTGTTGTTGCCGGGCAACCGGGCAATGGCTGCTCAAGTATTTGATCTTTCATTAGCGTACGGATTTCCATTGTAATGTTTTGTTCGCCTTATGGCATGACATTCTTCGAGCAGATCA

Full Affymetrix probeset data:

Annotations for 1638571_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime