Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638573_at:

>probe:Drosophila_2:1638573_at:573:319; Interrogation_Position=1544; Antisense; GCCCGTTGCACTATGACTTTGGATC
>probe:Drosophila_2:1638573_at:40:531; Interrogation_Position=1572; Antisense; GGGTCCTTTGCTGGCCTATCGCAAG
>probe:Drosophila_2:1638573_at:600:415; Interrogation_Position=1600; Antisense; GAGCGCGCTGGCTTCGTATTCTTCG
>probe:Drosophila_2:1638573_at:352:689; Interrogation_Position=1616; Antisense; TATTCTTCGCCACGGACGAGTGGCA
>probe:Drosophila_2:1638573_at:558:27; Interrogation_Position=1700; Antisense; ATACCGCCCTCAAGCCAGTAAGAGA
>probe:Drosophila_2:1638573_at:275:427; Interrogation_Position=1721; Antisense; GAGATCCTCGGTCCAAGAGGTCGAA
>probe:Drosophila_2:1638573_at:567:405; Interrogation_Position=1740; Antisense; GTCGAATTCCAATCCTTAGGCGTAG
>probe:Drosophila_2:1638573_at:520:123; Interrogation_Position=1811; Antisense; AGCCTGCTGTGTTGCACCAGTTGGC
>probe:Drosophila_2:1638573_at:698:325; Interrogation_Position=1874; Antisense; GCTGTCCGTTCCATTCGGTTCTAAT
>probe:Drosophila_2:1638573_at:292:711; Interrogation_Position=1892; Antisense; TTCTAATCCGTTCCGTGCCATTGTT
>probe:Drosophila_2:1638573_at:501:59; Interrogation_Position=1921; Antisense; ATGTTGCCGGTGAGGATTTCGCCAA
>probe:Drosophila_2:1638573_at:697:489; Interrogation_Position=1953; Antisense; GTAAACAACACGCAAGTCTTGGCCA
>probe:Drosophila_2:1638573_at:315:275; Interrogation_Position=1970; Antisense; CTTGGCCATTGTCCTTTGCAGATAG
>probe:Drosophila_2:1638573_at:702:481; Interrogation_Position=2014; Antisense; GTATGGGAACTACGTAATTCTCTAT

Paste this into a BLAST search page for me
GCCCGTTGCACTATGACTTTGGATCGGGTCCTTTGCTGGCCTATCGCAAGGAGCGCGCTGGCTTCGTATTCTTCGTATTCTTCGCCACGGACGAGTGGCAATACCGCCCTCAAGCCAGTAAGAGAGAGATCCTCGGTCCAAGAGGTCGAAGTCGAATTCCAATCCTTAGGCGTAGAGCCTGCTGTGTTGCACCAGTTGGCGCTGTCCGTTCCATTCGGTTCTAATTTCTAATCCGTTCCGTGCCATTGTTATGTTGCCGGTGAGGATTTCGCCAAGTAAACAACACGCAAGTCTTGGCCACTTGGCCATTGTCCTTTGCAGATAGGTATGGGAACTACGTAATTCTCTAT

Full Affymetrix probeset data:

Annotations for 1638573_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime