Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638575_at:

>probe:Drosophila_2:1638575_at:1:375; Interrogation_Position=2235; Antisense; GAAGTTCACGCTTTCGTTCGAGGAT
>probe:Drosophila_2:1638575_at:679:665; Interrogation_Position=2260; Antisense; TACAAGAATCTGTCCACCATGCTGG
>probe:Drosophila_2:1638575_at:237:623; Interrogation_Position=2279; Antisense; TGCTGGTGTTGCATATGCGCGCCGA
>probe:Drosophila_2:1638575_at:223:139; Interrogation_Position=2330; Antisense; ACGATACGGGCATCAAGCGCAGCAA
>probe:Drosophila_2:1638575_at:596:351; Interrogation_Position=2348; Antisense; GCAGCAATGTGGTCACCTGGTATCT
>probe:Drosophila_2:1638575_at:182:109; Interrogation_Position=2435; Antisense; AGAAGCTTATCGATCGCCTCATCTA
>probe:Drosophila_2:1638575_at:717:453; Interrogation_Position=2464; Antisense; GATCAGGTCATTATTCCGCTCAAGA
>probe:Drosophila_2:1638575_at:98:213; Interrogation_Position=2485; Antisense; AAGACATCCACGCTGAAGCCGAGAA
>probe:Drosophila_2:1638575_at:319:591; Interrogation_Position=2555; Antisense; TGGTGCATCCCAACTACGTTGTGGA
>probe:Drosophila_2:1638575_at:37:45; Interrogation_Position=2583; Antisense; ATCCCAGCCGATCAACAGTTTATTA
>probe:Drosophila_2:1638575_at:219:669; Interrogation_Position=2606; Antisense; TACTATGCCCTAAATCTAGCTGGTT
>probe:Drosophila_2:1638575_at:343:289; Interrogation_Position=2624; Antisense; GCTGGTTAAGTTTCTGTTTCCGCGT
>probe:Drosophila_2:1638575_at:503:541; Interrogation_Position=2740; Antisense; GGTTCAGTTACGTTCCAAATCATTC
>probe:Drosophila_2:1638575_at:175:165; Interrogation_Position=2756; Antisense; AAATCATTCATGTTTTCGCCGAAAT

Paste this into a BLAST search page for me
GAAGTTCACGCTTTCGTTCGAGGATTACAAGAATCTGTCCACCATGCTGGTGCTGGTGTTGCATATGCGCGCCGAACGATACGGGCATCAAGCGCAGCAAGCAGCAATGTGGTCACCTGGTATCTAGAAGCTTATCGATCGCCTCATCTAGATCAGGTCATTATTCCGCTCAAGAAAGACATCCACGCTGAAGCCGAGAATGGTGCATCCCAACTACGTTGTGGAATCCCAGCCGATCAACAGTTTATTATACTATGCCCTAAATCTAGCTGGTTGCTGGTTAAGTTTCTGTTTCCGCGTGGTTCAGTTACGTTCCAAATCATTCAAATCATTCATGTTTTCGCCGAAAT

Full Affymetrix probeset data:

Annotations for 1638575_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime