FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638580_at:

>probe:Drosophila_2:1638580_at:628:499; Interrogation_Position=443; Antisense; GTCTGAACCGGGATATATTCACAAC
>probe:Drosophila_2:1638580_at:415:711; Interrogation_Position=460; Antisense; TTCACAACAATTCGCATTACTCGCT
>probe:Drosophila_2:1638580_at:173:15; Interrogation_Position=475; Antisense; ATTACTCGCTGCCATTGGATCATGA
>probe:Drosophila_2:1638580_at:658:727; Interrogation_Position=489; Antisense; TTGGATCATGATTTGCCACCCAGTC
>probe:Drosophila_2:1638580_at:69:263; Interrogation_Position=535; Antisense; CAGCCCTGCCGCTGAGGAATGGAGT
>probe:Drosophila_2:1638580_at:125:595; Interrogation_Position=559; Antisense; TGGGCATGGCCCTGATCCATGGCAA
>probe:Drosophila_2:1638580_at:708:605; Interrogation_Position=571; Antisense; TGATCCATGGCAACACCACTGGGCG
>probe:Drosophila_2:1638580_at:596:67; Interrogation_Position=577; Antisense; ATGGCAACACCACTGGGCGCAGATC
>probe:Drosophila_2:1638580_at:608:523; Interrogation_Position=591; Antisense; GGGCGCAGATCCTTCAACAACAATA
>probe:Drosophila_2:1638580_at:701:185; Interrogation_Position=615; Antisense; AACAATGTGTCTACACTGTCCAACA
>probe:Drosophila_2:1638580_at:567:515; Interrogation_Position=621; Antisense; GTGTCTACACTGTCCAACAACAATC
>probe:Drosophila_2:1638580_at:134:37; Interrogation_Position=643; Antisense; ATCATCATGGCATTGGTGGCGGAGT
>probe:Drosophila_2:1638580_at:28:729; Interrogation_Position=679; Antisense; TTGGCGGCACTGTGGGCAACAACAA
>probe:Drosophila_2:1638580_at:372:197; Interrogation_Position=702; Antisense; AACGGGAGTCTGAGGCGGTATCACT

Paste this into a BLAST search page for me
GTCTGAACCGGGATATATTCACAACTTCACAACAATTCGCATTACTCGCTATTACTCGCTGCCATTGGATCATGATTGGATCATGATTTGCCACCCAGTCCAGCCCTGCCGCTGAGGAATGGAGTTGGGCATGGCCCTGATCCATGGCAATGATCCATGGCAACACCACTGGGCGATGGCAACACCACTGGGCGCAGATCGGGCGCAGATCCTTCAACAACAATAAACAATGTGTCTACACTGTCCAACAGTGTCTACACTGTCCAACAACAATCATCATCATGGCATTGGTGGCGGAGTTTGGCGGCACTGTGGGCAACAACAAAACGGGAGTCTGAGGCGGTATCACT

Full Affymetrix probeset data:

Annotations for 1638580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720