FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638581_at:

>probe:Drosophila_2:1638581_at:269:207; Interrogation_Position=2505; Antisense; AAGCGGGAATGTGCACTTTTGTCAT
>probe:Drosophila_2:1638581_at:421:659; Interrogation_Position=2541; Antisense; TAACTATTTTGTCGCCAACAGATGC
>probe:Drosophila_2:1638581_at:31:447; Interrogation_Position=2561; Antisense; GATGCGAATTCCAGTTTTGTGTTTA
>probe:Drosophila_2:1638581_at:443:575; Interrogation_Position=2614; Antisense; GGCGTAGTATATATCCTGTGTTCTG
>probe:Drosophila_2:1638581_at:219:647; Interrogation_Position=2640; Antisense; TCAGGCAGTTTAGTTTTAGTCGGGT
>probe:Drosophila_2:1638581_at:322:523; Interrogation_Position=2677; Antisense; GGGCTATAGCCGCAGTCCTTCTGAC
>probe:Drosophila_2:1638581_at:396:713; Interrogation_Position=2718; Antisense; TTCTCGCGATCGGAAAACGTTCTGG
>probe:Drosophila_2:1638581_at:396:571; Interrogation_Position=2787; Antisense; GGCTATATGCAAAGACGACACTGTC
>probe:Drosophila_2:1638581_at:377:527; Interrogation_Position=2816; Antisense; GGGAATCCTAACATACGCGCGAGTA
>probe:Drosophila_2:1638581_at:665:133; Interrogation_Position=2830; Antisense; ACGCGCGAGTATGCTGTAGTCAATC
>probe:Drosophila_2:1638581_at:146:239; Interrogation_Position=2886; Antisense; AATCTCCAAGCGTTATTTATCCCAC
>probe:Drosophila_2:1638581_at:239:45; Interrogation_Position=2904; Antisense; ATCCCACATCCCGTTCAGAGGAATA
>probe:Drosophila_2:1638581_at:31:469; Interrogation_Position=2941; Antisense; GTTGTTGCACACAAGCGATTTGCAT
>probe:Drosophila_2:1638581_at:66:19; Interrogation_Position=2958; Antisense; ATTTGCATGCTAACGATATCTACTG

Paste this into a BLAST search page for me
AAGCGGGAATGTGCACTTTTGTCATTAACTATTTTGTCGCCAACAGATGCGATGCGAATTCCAGTTTTGTGTTTAGGCGTAGTATATATCCTGTGTTCTGTCAGGCAGTTTAGTTTTAGTCGGGTGGGCTATAGCCGCAGTCCTTCTGACTTCTCGCGATCGGAAAACGTTCTGGGGCTATATGCAAAGACGACACTGTCGGGAATCCTAACATACGCGCGAGTAACGCGCGAGTATGCTGTAGTCAATCAATCTCCAAGCGTTATTTATCCCACATCCCACATCCCGTTCAGAGGAATAGTTGTTGCACACAAGCGATTTGCATATTTGCATGCTAACGATATCTACTG

Full Affymetrix probeset data:

Annotations for 1638581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720