FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638582_at:

>probe:Drosophila_2:1638582_at:400:79; Interrogation_Position=1010; Antisense; AGGTCCTTCCGTGGTATGAGTCCTA
>probe:Drosophila_2:1638582_at:48:611; Interrogation_Position=1100; Antisense; TGACCTTCAACAATATTCGCCTGCT
>probe:Drosophila_2:1638582_at:478:619; Interrogation_Position=1121; Antisense; TGCTCCACGGACGTACTGGTTATGA
>probe:Drosophila_2:1638582_at:135:433; Interrogation_Position=1158; Antisense; GAGTCCGCGCTATATTGTGGGCGCC
>probe:Drosophila_2:1638582_at:28:529; Interrogation_Position=1193; Antisense; GGGACATCATATATTCGCGCCTAAG
>probe:Drosophila_2:1638582_at:509:655; Interrogation_Position=1214; Antisense; TAAGGGTCCTCGAGGTGCCAGCTCT
>probe:Drosophila_2:1638582_at:452:313; Interrogation_Position=1230; Antisense; GCCAGCTCTCGGGATCCTCGAAGTA
>probe:Drosophila_2:1638582_at:647:89; Interrogation_Position=713; Antisense; AGTACAAGCCAAGCGTCAACATCCT
>probe:Drosophila_2:1638582_at:532:611; Interrogation_Position=737; Antisense; TGCACTGCGTTGTCCAAACGGATTC
>probe:Drosophila_2:1638582_at:361:23; Interrogation_Position=776; Antisense; ATATGCTCGTGGATGGCTTCCATGT
>probe:Drosophila_2:1638582_at:425:621; Interrogation_Position=812; Antisense; TGCGTCGCGATCATCCCGAAGACTT
>probe:Drosophila_2:1638582_at:475:433; Interrogation_Position=912; Antisense; GAGGGCACCAGTCATTTGCTTGGAC
>probe:Drosophila_2:1638582_at:199:545; Interrogation_Position=956; Antisense; GGATAAATCACAGCGTGCCGCAGCG
>probe:Drosophila_2:1638582_at:580:527; Interrogation_Position=980; Antisense; GGGACAGTCACTTCAATGTGCCGCT

Paste this into a BLAST search page for me
AGGTCCTTCCGTGGTATGAGTCCTATGACCTTCAACAATATTCGCCTGCTTGCTCCACGGACGTACTGGTTATGAGAGTCCGCGCTATATTGTGGGCGCCGGGACATCATATATTCGCGCCTAAGTAAGGGTCCTCGAGGTGCCAGCTCTGCCAGCTCTCGGGATCCTCGAAGTAAGTACAAGCCAAGCGTCAACATCCTTGCACTGCGTTGTCCAAACGGATTCATATGCTCGTGGATGGCTTCCATGTTGCGTCGCGATCATCCCGAAGACTTGAGGGCACCAGTCATTTGCTTGGACGGATAAATCACAGCGTGCCGCAGCGGGGACAGTCACTTCAATGTGCCGCT

Full Affymetrix probeset data:

Annotations for 1638582_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720