Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638584_at:

>probe:Drosophila_2:1638584_at:129:565; Interrogation_Position=1444; Antisense; GGAATCGGCTTACATCCAACTACGA
>probe:Drosophila_2:1638584_at:505:187; Interrogation_Position=1486; Antisense; AACACATCATCGAACTGGGCGGCAC
>probe:Drosophila_2:1638584_at:216:595; Interrogation_Position=1501; Antisense; TGGGCGGCACTCCAGATGGTCAAAC
>probe:Drosophila_2:1638584_at:600:177; Interrogation_Position=1522; Antisense; AAACATTGCCCAAAGCGGCCGACTG
>probe:Drosophila_2:1638584_at:113:1; Interrogation_Position=1559; Antisense; ATCCCTTTTTTATCCCGTCGATGAG
>probe:Drosophila_2:1638584_at:207:565; Interrogation_Position=1605; Antisense; GGAATACCGGAGCACTTCTGCACCT
>probe:Drosophila_2:1638584_at:675:353; Interrogation_Position=1624; Antisense; GCACCTGTGTGCCTTACAAAAGACT
>probe:Drosophila_2:1638584_at:621:365; Interrogation_Position=1693; Antisense; GAATCAACGAGTATCTGGCCGGCAG
>probe:Drosophila_2:1638584_at:673:459; Interrogation_Position=1730; Antisense; GATTTGTTCTGAACTCACGCTCAGC
>probe:Drosophila_2:1638584_at:560:135; Interrogation_Position=1746; Antisense; ACGCTCAGCTATATTCACCTGACAG
>probe:Drosophila_2:1638584_at:352:501; Interrogation_Position=1779; Antisense; GTCGAGCTAGACCAGAACTTCCACG
>probe:Drosophila_2:1638584_at:302:221; Interrogation_Position=1848; Antisense; AAGGTGAAGCAGAACTCCGCCGACT
>probe:Drosophila_2:1638584_at:509:289; Interrogation_Position=1875; Antisense; CGGGCCACCGTTATCTTCAATAATG
>probe:Drosophila_2:1638584_at:129:81; Interrogation_Position=1921; Antisense; AGGTGCCTACTATTAGTCGGCTCGA

Paste this into a BLAST search page for me
GGAATCGGCTTACATCCAACTACGAAACACATCATCGAACTGGGCGGCACTGGGCGGCACTCCAGATGGTCAAACAAACATTGCCCAAAGCGGCCGACTGATCCCTTTTTTATCCCGTCGATGAGGGAATACCGGAGCACTTCTGCACCTGCACCTGTGTGCCTTACAAAAGACTGAATCAACGAGTATCTGGCCGGCAGGATTTGTTCTGAACTCACGCTCAGCACGCTCAGCTATATTCACCTGACAGGTCGAGCTAGACCAGAACTTCCACGAAGGTGAAGCAGAACTCCGCCGACTCGGGCCACCGTTATCTTCAATAATGAGGTGCCTACTATTAGTCGGCTCGA

Full Affymetrix probeset data:

Annotations for 1638584_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime