Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638585_at:

>probe:Drosophila_2:1638585_at:656:633; Interrogation_Position=1635; Antisense; TCGCTCGACAAATGCTTCACGGATT
>probe:Drosophila_2:1638585_at:8:635; Interrogation_Position=1738; Antisense; TCGACGTACGCAGTGTTTCCAGGAG
>probe:Drosophila_2:1638585_at:405:479; Interrogation_Position=1752; Antisense; GTTTCCAGGAGCAGTACGCCATATT
>probe:Drosophila_2:1638585_at:464:229; Interrogation_Position=1838; Antisense; AATGGAGCACTGGATATCGCCTATC
>probe:Drosophila_2:1638585_at:721:367; Interrogation_Position=1885; Antisense; GAATGCTGCCGAAACACCGGTTATA
>probe:Drosophila_2:1638585_at:164:169; Interrogation_Position=1914; Antisense; AAAGGGAACGTCTGCCACTCCTGGA
>probe:Drosophila_2:1638585_at:646:683; Interrogation_Position=1961; Antisense; TATCTGGGTTATGCGCAGCTGTACT
>probe:Drosophila_2:1638585_at:729:119; Interrogation_Position=1977; Antisense; AGCTGTACTGCACCGATTATCCGGA
>probe:Drosophila_2:1638585_at:263:123; Interrogation_Position=2010; Antisense; AGCGTTTTGATGAGCTTCCCGAGCA
>probe:Drosophila_2:1638585_at:635:285; Interrogation_Position=2039; Antisense; CGGGTTAACACAGCGCTATCCAATT
>probe:Drosophila_2:1638585_at:73:683; Interrogation_Position=2055; Antisense; TATCCAATTCGCAACAGTTCGCCAA
>probe:Drosophila_2:1638585_at:724:233; Interrogation_Position=2078; Antisense; AATGCCTACGGTTGCTCCAGGGAGG
>probe:Drosophila_2:1638585_at:168:297; Interrogation_Position=2117; Antisense; CGCTTTAAGTGCACTCTCTACTGAG
>probe:Drosophila_2:1638585_at:461:421; Interrogation_Position=2144; Antisense; GAGAATTTTGCCATCCATATACCTA

Paste this into a BLAST search page for me
TCGCTCGACAAATGCTTCACGGATTTCGACGTACGCAGTGTTTCCAGGAGGTTTCCAGGAGCAGTACGCCATATTAATGGAGCACTGGATATCGCCTATCGAATGCTGCCGAAACACCGGTTATAAAAGGGAACGTCTGCCACTCCTGGATATCTGGGTTATGCGCAGCTGTACTAGCTGTACTGCACCGATTATCCGGAAGCGTTTTGATGAGCTTCCCGAGCACGGGTTAACACAGCGCTATCCAATTTATCCAATTCGCAACAGTTCGCCAAAATGCCTACGGTTGCTCCAGGGAGGCGCTTTAAGTGCACTCTCTACTGAGGAGAATTTTGCCATCCATATACCTA

Full Affymetrix probeset data:

Annotations for 1638585_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime