Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638586_at:

>probe:Drosophila_2:1638586_at:722:505; Interrogation_Position=1021; Antisense; GTGCCCATGTACTCATACCTTTATG
>probe:Drosophila_2:1638586_at:675:411; Interrogation_Position=1089; Antisense; GACCCTGCATTCCAGCGATCTGTAA
>probe:Drosophila_2:1638586_at:535:327; Interrogation_Position=1103; Antisense; GCGATCTGTAAAGCGCTTGCACGCT
>probe:Drosophila_2:1638586_at:225:113; Interrogation_Position=1135; Antisense; AGCATTACCGAACCGAATCCAACGA
>probe:Drosophila_2:1638586_at:54:181; Interrogation_Position=1179; Antisense; AAAAACTGCCTAGCCAATCGTGGAC
>probe:Drosophila_2:1638586_at:648:237; Interrogation_Position=1194; Antisense; AATCGTGGACAGAACTACCTCAGCC
>probe:Drosophila_2:1638586_at:612:309; Interrogation_Position=1251; Antisense; CCAATCTTTGGACCTCGACGATATA
>probe:Drosophila_2:1638586_at:281:661; Interrogation_Position=1301; Antisense; TAACGCGTATTTACACTTCCAGCTA
>probe:Drosophila_2:1638586_at:332:139; Interrogation_Position=1325; Antisense; ACGTGACTGGTTATGATATTCGGCA
>probe:Drosophila_2:1638586_at:277:239; Interrogation_Position=1358; Antisense; AATAATCCCTAAGTGATCCTTCCTC
>probe:Drosophila_2:1638586_at:600:447; Interrogation_Position=1372; Antisense; GATCCTTCCTCATATGCTAAGCGAT
>probe:Drosophila_2:1638586_at:421:447; Interrogation_Position=1411; Antisense; GATGCCCGGATTTACGTCTAAGTTA
>probe:Drosophila_2:1638586_at:65:701; Interrogation_Position=1459; Antisense; TTTTATAAGCTGATCGTGGTTACCA
>probe:Drosophila_2:1638586_at:533:517; Interrogation_Position=1474; Antisense; GTGGTTACCAGATACATACGATTTA

Paste this into a BLAST search page for me
GTGCCCATGTACTCATACCTTTATGGACCCTGCATTCCAGCGATCTGTAAGCGATCTGTAAAGCGCTTGCACGCTAGCATTACCGAACCGAATCCAACGAAAAAACTGCCTAGCCAATCGTGGACAATCGTGGACAGAACTACCTCAGCCCCAATCTTTGGACCTCGACGATATATAACGCGTATTTACACTTCCAGCTAACGTGACTGGTTATGATATTCGGCAAATAATCCCTAAGTGATCCTTCCTCGATCCTTCCTCATATGCTAAGCGATGATGCCCGGATTTACGTCTAAGTTATTTTATAAGCTGATCGTGGTTACCAGTGGTTACCAGATACATACGATTTA

Full Affymetrix probeset data:

Annotations for 1638586_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime