Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638587_at:

>probe:Drosophila_2:1638587_at:32:535; Interrogation_Position=2640; Antisense; GGTGTACACCAGTCAGAGCGATGTT
>probe:Drosophila_2:1638587_at:106:517; Interrogation_Position=2675; Antisense; GTGTGCTGCTCTATGAGATCACCAC
>probe:Drosophila_2:1638587_at:651:427; Interrogation_Position=2689; Antisense; GAGATCACCACTCTCGGTGGAATGC
>probe:Drosophila_2:1638587_at:551:585; Interrogation_Position=2706; Antisense; TGGAATGCCATATCCGTCGGTGTCT
>probe:Drosophila_2:1638587_at:580:267; Interrogation_Position=2733; Antisense; CAGTGATCTCTTGCAGCTACTGCGA
>probe:Drosophila_2:1638587_at:282:117; Interrogation_Position=2747; Antisense; AGCTACTGCGACAAGGTCATCGGAT
>probe:Drosophila_2:1638587_at:276:393; Interrogation_Position=2815; Antisense; GAAAGCTGCTGGAGCTCCGTGCCAT
>probe:Drosophila_2:1638587_at:655:505; Interrogation_Position=2833; Antisense; GTGCCATCACACAGGCCAACATTTT
>probe:Drosophila_2:1638587_at:334:717; Interrogation_Position=2856; Antisense; TTCCGCCCTTAAACACAGACTTGGT
>probe:Drosophila_2:1638587_at:20:59; Interrogation_Position=2884; Antisense; ATGATTTTGGCCACTAACGATGTTC
>probe:Drosophila_2:1638587_at:218:283; Interrogation_Position=2926; Antisense; CTGCAAGCTGCAACCGAGTCAAAAT
>probe:Drosophila_2:1638587_at:204:103; Interrogation_Position=3003; Antisense; AGAGCTATACCTAGAACCTTTGAAT
>probe:Drosophila_2:1638587_at:478:713; Interrogation_Position=3090; Antisense; TTCAGACAATGCTATGCGCCAGATA
>probe:Drosophila_2:1638587_at:145:323; Interrogation_Position=3105; Antisense; GCGCCAGATAACCTTGCATAGCAAT

Paste this into a BLAST search page for me
GGTGTACACCAGTCAGAGCGATGTTGTGTGCTGCTCTATGAGATCACCACGAGATCACCACTCTCGGTGGAATGCTGGAATGCCATATCCGTCGGTGTCTCAGTGATCTCTTGCAGCTACTGCGAAGCTACTGCGACAAGGTCATCGGATGAAAGCTGCTGGAGCTCCGTGCCATGTGCCATCACACAGGCCAACATTTTTTCCGCCCTTAAACACAGACTTGGTATGATTTTGGCCACTAACGATGTTCCTGCAAGCTGCAACCGAGTCAAAATAGAGCTATACCTAGAACCTTTGAATTTCAGACAATGCTATGCGCCAGATAGCGCCAGATAACCTTGCATAGCAAT

Full Affymetrix probeset data:

Annotations for 1638587_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime