FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638589_at:

>probe:Drosophila_2:1638589_at:561:63; Interrogation_Position=13; Antisense; ATGGTCGAGGCCAATGTCCTTCGAA
>probe:Drosophila_2:1638589_at:29:209; Interrogation_Position=148; Antisense; AAGCACTGTTCCAATATTCCGCAAT
>probe:Drosophila_2:1638589_at:255:417; Interrogation_Position=175; Antisense; GAGGGTAAATTCCAACCGCCATTGC
>probe:Drosophila_2:1638589_at:388:173; Interrogation_Position=201; Antisense; AAAGCAGACCTATTTTGGCAACAAA
>probe:Drosophila_2:1638589_at:218:709; Interrogation_Position=247; Antisense; TTGCCAGAAATTGTTCCTGCCGGTT
>probe:Drosophila_2:1638589_at:719:229; Interrogation_Position=25; Antisense; AATGTCCTTCGAAGCTCGACGGGAG
>probe:Drosophila_2:1638589_at:211:307; Interrogation_Position=262; Antisense; CCTGCCGGTTTTTATCTGATTGTGA
>probe:Drosophila_2:1638589_at:641:465; Interrogation_Position=279; Antisense; GATTGTGATCAAATGCTATGGACCA
>probe:Drosophila_2:1638589_at:243:681; Interrogation_Position=295; Antisense; TATGGACCAGGTCAACCCACATGGA
>probe:Drosophila_2:1638589_at:271:201; Interrogation_Position=308; Antisense; AACCCACATGGAACACTACGTCAGT
>probe:Drosophila_2:1638589_at:44:635; Interrogation_Position=40; Antisense; TCGACGGGAGATGTCAGCGACTACA
>probe:Drosophila_2:1638589_at:271:123; Interrogation_Position=55; Antisense; AGCGACTACAAGCTGCTTCCTTGGG
>probe:Drosophila_2:1638589_at:466:523; Interrogation_Position=77; Antisense; GGGCCATTCCCAAGCAATCGCTATA
>probe:Drosophila_2:1638589_at:214:339; Interrogation_Position=96; Antisense; GCTATACGAACATCTGAACACCTAT

Paste this into a BLAST search page for me
ATGGTCGAGGCCAATGTCCTTCGAAAAGCACTGTTCCAATATTCCGCAATGAGGGTAAATTCCAACCGCCATTGCAAAGCAGACCTATTTTGGCAACAAATTGCCAGAAATTGTTCCTGCCGGTTAATGTCCTTCGAAGCTCGACGGGAGCCTGCCGGTTTTTATCTGATTGTGAGATTGTGATCAAATGCTATGGACCATATGGACCAGGTCAACCCACATGGAAACCCACATGGAACACTACGTCAGTTCGACGGGAGATGTCAGCGACTACAAGCGACTACAAGCTGCTTCCTTGGGGGGCCATTCCCAAGCAATCGCTATAGCTATACGAACATCTGAACACCTAT

Full Affymetrix probeset data:

Annotations for 1638589_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720