Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638590_at:

>probe:Drosophila_2:1638590_at:231:349; Interrogation_Position=1178; Antisense; GCAGGCCTCCATGGATGTGTATGCA
>probe:Drosophila_2:1638590_at:666:483; Interrogation_Position=1196; Antisense; GTATGCACCCAGTATAGTCAGTTGT
>probe:Drosophila_2:1638590_at:417:467; Interrogation_Position=1216; Antisense; GTTGTCTAGCGCGAATACTGCAGTT
>probe:Drosophila_2:1638590_at:336:193; Interrogation_Position=1258; Antisense; AACTCATTCCATTAGGCGAACGCCA
>probe:Drosophila_2:1638590_at:130:79; Interrogation_Position=1297; Antisense; AGGATCTGGCGCACATTTGGAGTCG
>probe:Drosophila_2:1638590_at:350:725; Interrogation_Position=1313; Antisense; TTGGAGTCGCCTGAAGTACTTCTAT
>probe:Drosophila_2:1638590_at:356:489; Interrogation_Position=1328; Antisense; GTACTTCTATCACAAGGAGGCCTTC
>probe:Drosophila_2:1638590_at:656:437; Interrogation_Position=1344; Antisense; GAGGCCTTCTTAAATCTTTTGGAAT
>probe:Drosophila_2:1638590_at:696:371; Interrogation_Position=1411; Antisense; GAAGTGATCCCGACGCCAATGAGTT
>probe:Drosophila_2:1638590_at:685:107; Interrogation_Position=1486; Antisense; AGAACGCCTTGAAGTTGCTGCGCCT
>probe:Drosophila_2:1638590_at:414:323; Interrogation_Position=1505; Antisense; GCGCCTGTTGGCATGTATGGTGATA
>probe:Drosophila_2:1638590_at:305:727; Interrogation_Position=1582; Antisense; TTGTGTCTGCACTCAAAGCCGGAAA
>probe:Drosophila_2:1638590_at:493:107; Interrogation_Position=1610; Antisense; AGAAGCCATTTTCTCAAGGGCACTT
>probe:Drosophila_2:1638590_at:595:203; Interrogation_Position=1672; Antisense; AAGCCTAAACAACATGCCTCCATGA

Paste this into a BLAST search page for me
GCAGGCCTCCATGGATGTGTATGCAGTATGCACCCAGTATAGTCAGTTGTGTTGTCTAGCGCGAATACTGCAGTTAACTCATTCCATTAGGCGAACGCCAAGGATCTGGCGCACATTTGGAGTCGTTGGAGTCGCCTGAAGTACTTCTATGTACTTCTATCACAAGGAGGCCTTCGAGGCCTTCTTAAATCTTTTGGAATGAAGTGATCCCGACGCCAATGAGTTAGAACGCCTTGAAGTTGCTGCGCCTGCGCCTGTTGGCATGTATGGTGATATTGTGTCTGCACTCAAAGCCGGAAAAGAAGCCATTTTCTCAAGGGCACTTAAGCCTAAACAACATGCCTCCATGA

Full Affymetrix probeset data:

Annotations for 1638590_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime