Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638591_at:

>probe:Drosophila_2:1638591_at:87:253; Interrogation_Position=1594; Antisense; CAAAAGATTTGCTCTTCCTCCAATC
>probe:Drosophila_2:1638591_at:180:193; Interrogation_Position=1624; Antisense; AACTATCGCGCCTTGCTATGTGTCA
>probe:Drosophila_2:1638591_at:218:681; Interrogation_Position=1640; Antisense; TATGTGTCATTTAAATCCCCTGCGG
>probe:Drosophila_2:1638591_at:45:619; Interrogation_Position=1660; Antisense; TGCGGTATTGTTTAGCCCCAGTGGC
>probe:Drosophila_2:1638591_at:185:475; Interrogation_Position=1701; Antisense; GTTACAAGAACTTACCAGCTGGCCT
>probe:Drosophila_2:1638591_at:235:121; Interrogation_Position=1717; Antisense; AGCTGGCCTATTGTCATACTGTTTT
>probe:Drosophila_2:1638591_at:404:271; Interrogation_Position=1731; Antisense; CATACTGTTTTGGAGCGCAACGCTC
>probe:Drosophila_2:1638591_at:221:143; Interrogation_Position=1763; Antisense; ACTGGCTACAGTTTACGGTCATGAA
>probe:Drosophila_2:1638591_at:309:163; Interrogation_Position=1788; Antisense; AAATGCATGCCCGATGAGACGCTGG
>probe:Drosophila_2:1638591_at:708:419; Interrogation_Position=1803; Antisense; GAGACGCTGGAATCGTTTTTTCCCT
>probe:Drosophila_2:1638591_at:439:717; Interrogation_Position=1822; Antisense; TTCCCTTCGATCCTTATGTACTTAA
>probe:Drosophila_2:1638591_at:300:593; Interrogation_Position=1916; Antisense; TGGGTCTAACAAATACGGGCATTCT
>probe:Drosophila_2:1638591_at:258:345; Interrogation_Position=1934; Antisense; GCATTCTAGGAAACGTGGTGACTCT
>probe:Drosophila_2:1638591_at:11:245; Interrogation_Position=2044; Antisense; AATTTCATTTCGGATCTTCGCCATG

Paste this into a BLAST search page for me
CAAAAGATTTGCTCTTCCTCCAATCAACTATCGCGCCTTGCTATGTGTCATATGTGTCATTTAAATCCCCTGCGGTGCGGTATTGTTTAGCCCCAGTGGCGTTACAAGAACTTACCAGCTGGCCTAGCTGGCCTATTGTCATACTGTTTTCATACTGTTTTGGAGCGCAACGCTCACTGGCTACAGTTTACGGTCATGAAAAATGCATGCCCGATGAGACGCTGGGAGACGCTGGAATCGTTTTTTCCCTTTCCCTTCGATCCTTATGTACTTAATGGGTCTAACAAATACGGGCATTCTGCATTCTAGGAAACGTGGTGACTCTAATTTCATTTCGGATCTTCGCCATG

Full Affymetrix probeset data:

Annotations for 1638591_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime