Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638594_at:

>probe:Drosophila_2:1638594_at:572:127; Interrogation_Position=3106; Antisense; ACCATTGTAACCAAGGATCCTGCGG
>probe:Drosophila_2:1638594_at:336:37; Interrogation_Position=3158; Antisense; ATCATCTCATTTGCGAGGCAGCTGC
>probe:Drosophila_2:1638594_at:178:337; Interrogation_Position=3178; Antisense; GCTGCCACGGCTAACAAATATTTTA
>probe:Drosophila_2:1638594_at:193:117; Interrogation_Position=3231; Antisense; AGCATTTCTGATCATCGTTTTCGAT
>probe:Drosophila_2:1638594_at:128:683; Interrogation_Position=3262; Antisense; TATGTTCTGGAGACGCTACTGGGAA
>probe:Drosophila_2:1638594_at:239:483; Interrogation_Position=3354; Antisense; GTATCTGATCGCCATAATTTCCATT
>probe:Drosophila_2:1638594_at:436:25; Interrogation_Position=3427; Antisense; ATAGTGCACTCCCTACTCAATAAAA
>probe:Drosophila_2:1638594_at:228:351; Interrogation_Position=3480; Antisense; GCAGCAATTCTCCATGCAGTTGATG
>probe:Drosophila_2:1638594_at:246:707; Interrogation_Position=3521; Antisense; TTACTGCAGCTGGTCTGTTCAACAT
>probe:Drosophila_2:1638594_at:286:603; Interrogation_Position=3536; Antisense; TGTTCAACATCGACCGCACATTGTA
>probe:Drosophila_2:1638594_at:328:357; Interrogation_Position=3551; Antisense; GCACATTGTATTTCACGATCAGCGG
>probe:Drosophila_2:1638594_at:523:719; Interrogation_Position=3580; Antisense; TTGACCACTTATCTCATCATCTTGC
>probe:Drosophila_2:1638594_at:223:35; Interrogation_Position=3598; Antisense; ATCTTGCTGCAGTTCACATCCAATT
>probe:Drosophila_2:1638594_at:245:229; Interrogation_Position=3643; Antisense; AATGGCAGCTCTTGCTGTGAGACCT

Paste this into a BLAST search page for me
ACCATTGTAACCAAGGATCCTGCGGATCATCTCATTTGCGAGGCAGCTGCGCTGCCACGGCTAACAAATATTTTAAGCATTTCTGATCATCGTTTTCGATTATGTTCTGGAGACGCTACTGGGAAGTATCTGATCGCCATAATTTCCATTATAGTGCACTCCCTACTCAATAAAAGCAGCAATTCTCCATGCAGTTGATGTTACTGCAGCTGGTCTGTTCAACATTGTTCAACATCGACCGCACATTGTAGCACATTGTATTTCACGATCAGCGGTTGACCACTTATCTCATCATCTTGCATCTTGCTGCAGTTCACATCCAATTAATGGCAGCTCTTGCTGTGAGACCT

Full Affymetrix probeset data:

Annotations for 1638594_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime