Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638596_at:

>probe:Drosophila_2:1638596_at:27:117; Interrogation_Position=431; Antisense; AGCATCAACACTTATACGCCTGGCA
>probe:Drosophila_2:1638596_at:217:135; Interrogation_Position=446; Antisense; ACGCCTGGCACCAAGAGTTGCAGTT
>probe:Drosophila_2:1638596_at:220:471; Interrogation_Position=494; Antisense; GTTCCTGCAACAGCATTAGCTCTTA
>probe:Drosophila_2:1638596_at:159:617; Interrogation_Position=520; Antisense; TGCAAGCCAGCAACATCGACGATTC
>probe:Drosophila_2:1638596_at:623:357; Interrogation_Position=550; Antisense; GCAACACCTCCTAACAATTTTCATA
>probe:Drosophila_2:1638596_at:362:561; Interrogation_Position=582; Antisense; GGAAGCCAGTTTTGAAGACTACCGT
>probe:Drosophila_2:1638596_at:49:213; Interrogation_Position=596; Antisense; AAGACTACCGTAACAATTCCTGCAG
>probe:Drosophila_2:1638596_at:335:247; Interrogation_Position=610; Antisense; AATTCCTGCAGTTCTGGTACTGAAG
>probe:Drosophila_2:1638596_at:381:401; Interrogation_Position=640; Antisense; GACATCCTCGACTATATATCACTCT
>probe:Drosophila_2:1638596_at:103:23; Interrogation_Position=655; Antisense; ATATCACTCTGGCAGGACGACCTGT
>probe:Drosophila_2:1638596_at:218:97; Interrogation_Position=688; Antisense; AGATCAAATCTTCAGCTATTGCTAG
>probe:Drosophila_2:1638596_at:341:689; Interrogation_Position=704; Antisense; TATTGCTAGTCGCACCCAACCATAA
>probe:Drosophila_2:1638596_at:200:161; Interrogation_Position=754; Antisense; ACAAGTATTACCTCAGCCACAAAGT
>probe:Drosophila_2:1638596_at:216:685; Interrogation_Position=782; Antisense; TATATTCCCTAGAACTACCTTTTTG

Paste this into a BLAST search page for me
AGCATCAACACTTATACGCCTGGCAACGCCTGGCACCAAGAGTTGCAGTTGTTCCTGCAACAGCATTAGCTCTTATGCAAGCCAGCAACATCGACGATTCGCAACACCTCCTAACAATTTTCATAGGAAGCCAGTTTTGAAGACTACCGTAAGACTACCGTAACAATTCCTGCAGAATTCCTGCAGTTCTGGTACTGAAGGACATCCTCGACTATATATCACTCTATATCACTCTGGCAGGACGACCTGTAGATCAAATCTTCAGCTATTGCTAGTATTGCTAGTCGCACCCAACCATAAACAAGTATTACCTCAGCCACAAAGTTATATTCCCTAGAACTACCTTTTTG

Full Affymetrix probeset data:

Annotations for 1638596_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime