Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638597_s_at:

>probe:Drosophila_2:1638597_s_at:463:217; Interrogation_Position=103; Antisense; AAGTTCAAGCATCAGAAGTCGCAGC
>probe:Drosophila_2:1638597_s_at:289:525; Interrogation_Position=156; Antisense; GGGCAACAACAAACGGAGGAACAGA
>probe:Drosophila_2:1638597_s_at:662:185; Interrogation_Position=163; Antisense; AACAAACGGAGGAACAGAGCAGGAC
>probe:Drosophila_2:1638597_s_at:588:365; Interrogation_Position=257; Antisense; GAATCGTCAGAGGATCGTCCCGGAA
>probe:Drosophila_2:1638597_s_at:200:497; Interrogation_Position=262; Antisense; GTCAGAGGATCGTCCCGGAAGCAGA
>probe:Drosophila_2:1638597_s_at:378:633; Interrogation_Position=274; Antisense; TCCCGGAAGCAGAGGAAGAGCTCTT
>probe:Drosophila_2:1638597_s_at:578:215; Interrogation_Position=310; Antisense; AAGATATCGGCCCAACACCAGATCC
>probe:Drosophila_2:1638597_s_at:607:365; Interrogation_Position=350; Antisense; GAATACCCAGCTCACTGACGCATTT
>probe:Drosophila_2:1638597_s_at:452:357; Interrogation_Position=507; Antisense; GCACAACTGTTGCTCAATGTGCAGT
>probe:Drosophila_2:1638597_s_at:16:231; Interrogation_Position=522; Antisense; AATGTGCAGTCGTTACCTCACTGAT
>probe:Drosophila_2:1638597_s_at:150:87; Interrogation_Position=529; Antisense; AGTCGTTACCTCACTGATGCTGGAG
>probe:Drosophila_2:1638597_s_at:327:195; Interrogation_Position=71; Antisense; AACTGCAGTCCCAATACCAGTCGAC
>probe:Drosophila_2:1638597_s_at:613:241; Interrogation_Position=83; Antisense; AATACCAGTCGACCGCATCCAAGTT
>probe:Drosophila_2:1638597_s_at:700:411; Interrogation_Position=93; Antisense; GACCGCATCCAAGTTCAAGCATCAG

Paste this into a BLAST search page for me
AAGTTCAAGCATCAGAAGTCGCAGCGGGCAACAACAAACGGAGGAACAGAAACAAACGGAGGAACAGAGCAGGACGAATCGTCAGAGGATCGTCCCGGAAGTCAGAGGATCGTCCCGGAAGCAGATCCCGGAAGCAGAGGAAGAGCTCTTAAGATATCGGCCCAACACCAGATCCGAATACCCAGCTCACTGACGCATTTGCACAACTGTTGCTCAATGTGCAGTAATGTGCAGTCGTTACCTCACTGATAGTCGTTACCTCACTGATGCTGGAGAACTGCAGTCCCAATACCAGTCGACAATACCAGTCGACCGCATCCAAGTTGACCGCATCCAAGTTCAAGCATCAG

Full Affymetrix probeset data:

Annotations for 1638597_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime