FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638598_at:

>probe:Drosophila_2:1638598_at:556:3; Interrogation_Position=2021; Antisense; ATTGGACACCACGTCACAGATCAAC
>probe:Drosophila_2:1638598_at:287:95; Interrogation_Position=2038; Antisense; AGATCAACAACAAGGCCATTCGCTT
>probe:Drosophila_2:1638598_at:680:635; Interrogation_Position=2057; Antisense; TCGCTTGATTTGTTGCCTGGATGAC
>probe:Drosophila_2:1638598_at:416:603; Interrogation_Position=2096; Antisense; TGTTCCGCCCGTAAGTGTGAGTGTG
>probe:Drosophila_2:1638598_at:269:73; Interrogation_Position=2125; Antisense; AGGAATATCCGTGGCAGGCTCCGGA
>probe:Drosophila_2:1638598_at:648:329; Interrogation_Position=2160; Antisense; GCGGAACAGGAGTATTCAGCCACCC
>probe:Drosophila_2:1638598_at:459:351; Interrogation_Position=2192; Antisense; GCAGACGGTGCAACAAGCTCTCATT
>probe:Drosophila_2:1638598_at:460:373; Interrogation_Position=2228; Antisense; GAAGTTGCCCAAGAACTACTCGCTC
>probe:Drosophila_2:1638598_at:622:669; Interrogation_Position=2244; Antisense; TACTCGCTCTCACATTTGTTGGACA
>probe:Drosophila_2:1638598_at:550:391; Interrogation_Position=2309; Antisense; GAAACCCAGAGCAGTCTGTGAACTT
>probe:Drosophila_2:1638598_at:113:511; Interrogation_Position=2326; Antisense; GTGAACTTTCCACTTTGCTGGGAGT
>probe:Drosophila_2:1638598_at:639:695; Interrogation_Position=2429; Antisense; TTTACCTAACTATCCGGCCTAATCA
>probe:Drosophila_2:1638598_at:233:273; Interrogation_Position=2462; Antisense; CATTTTTTCTATTTACGCTGGGCAA
>probe:Drosophila_2:1638598_at:100:697; Interrogation_Position=2500; Antisense; TTTAATTCCCAAAATGCCCCTCTGT

Paste this into a BLAST search page for me
ATTGGACACCACGTCACAGATCAACAGATCAACAACAAGGCCATTCGCTTTCGCTTGATTTGTTGCCTGGATGACTGTTCCGCCCGTAAGTGTGAGTGTGAGGAATATCCGTGGCAGGCTCCGGAGCGGAACAGGAGTATTCAGCCACCCGCAGACGGTGCAACAAGCTCTCATTGAAGTTGCCCAAGAACTACTCGCTCTACTCGCTCTCACATTTGTTGGACAGAAACCCAGAGCAGTCTGTGAACTTGTGAACTTTCCACTTTGCTGGGAGTTTTACCTAACTATCCGGCCTAATCACATTTTTTCTATTTACGCTGGGCAATTTAATTCCCAAAATGCCCCTCTGT

Full Affymetrix probeset data:

Annotations for 1638598_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720