FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638601_at:

>probe:Drosophila_2:1638601_at:514:215; Interrogation_Position=377; Antisense; AAGATTTTACTGATGCTCTGCTTAA
>probe:Drosophila_2:1638601_at:317:397; Interrogation_Position=415; Antisense; GACAAGAATGTTTCCCGTAATACAA
>probe:Drosophila_2:1638601_at:648:527; Interrogation_Position=468; Antisense; GGGACACTCAGCAGTTGGAAATTTG
>probe:Drosophila_2:1638601_at:10:163; Interrogation_Position=486; Antisense; AAATTTGGTAATGTTGGCACTGGCA
>probe:Drosophila_2:1638601_at:640:195; Interrogation_Position=528; Antisense; AACGATTGCGTTACACATCAGGAAT
>probe:Drosophila_2:1638601_at:628:229; Interrogation_Position=550; Antisense; AATGAGGTTGACACAGTTTCTGCTA
>probe:Drosophila_2:1638601_at:707:293; Interrogation_Position=623; Antisense; CGATGGCATCCATTTCAGAGGTTTT
>probe:Drosophila_2:1638601_at:478:99; Interrogation_Position=639; Antisense; AGAGGTTTTGCGATACTCTTCGTCC
>probe:Drosophila_2:1638601_at:168:9; Interrogation_Position=728; Antisense; ATTCCTCAATTTTTACCTTTCAGTG
>probe:Drosophila_2:1638601_at:12:537; Interrogation_Position=754; Antisense; TGGTAAACGTACATGCATAGGGCAA
>probe:Drosophila_2:1638601_at:75:543; Interrogation_Position=797; Antisense; GGATTTCTTTTACTTGCAAACATCA
>probe:Drosophila_2:1638601_at:722:23; Interrogation_Position=832; Antisense; TAACGTTAACAGTGCGGACTTTTCA
>probe:Drosophila_2:1638601_at:394:185; Interrogation_Position=871; Antisense; AAAATCCAGCATTGCCTTGCCAAAA
>probe:Drosophila_2:1638601_at:131:619; Interrogation_Position=899; Antisense; TGCTTTAAGCTTTCATTGCGGCCAA

Paste this into a BLAST search page for me
AAGATTTTACTGATGCTCTGCTTAAGACAAGAATGTTTCCCGTAATACAAGGGACACTCAGCAGTTGGAAATTTGAAATTTGGTAATGTTGGCACTGGCAAACGATTGCGTTACACATCAGGAATAATGAGGTTGACACAGTTTCTGCTACGATGGCATCCATTTCAGAGGTTTTAGAGGTTTTGCGATACTCTTCGTCCATTCCTCAATTTTTACCTTTCAGTGTGGTAAACGTACATGCATAGGGCAAGGATTTCTTTTACTTGCAAACATCATAACGTTAACAGTGCGGACTTTTCAAAAATCCAGCATTGCCTTGCCAAAATGCTTTAAGCTTTCATTGCGGCCAA

Full Affymetrix probeset data:

Annotations for 1638601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720