FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638603_at:

>probe:Drosophila_2:1638603_at:71:627; Interrogation_Position=116; Antisense; TCGTTTTCCAATACTAACAAATCGG
>probe:Drosophila_2:1638603_at:677:561; Interrogation_Position=139; Antisense; GGAACTTCAGAACCAACTACGAGTA
>probe:Drosophila_2:1638603_at:433:387; Interrogation_Position=15; Antisense; GAAAGTGAGGTTCGATCTTAACATA
>probe:Drosophila_2:1638603_at:564:171; Interrogation_Position=191; Antisense; AAAGAATTTTCTTCAATGGCGGATG
>probe:Drosophila_2:1638603_at:701:67; Interrogation_Position=206; Antisense; ATGGCGGATGAGCTAAATCACTTAA
>probe:Drosophila_2:1638603_at:542:275; Interrogation_Position=226; Antisense; CTTAATTGATGGCACTACTCCCAGC
>probe:Drosophila_2:1638603_at:121:147; Interrogation_Position=239; Antisense; ACTACTCCCAGCCATATTGAGACTT
>probe:Drosophila_2:1638603_at:141:705; Interrogation_Position=262; Antisense; TTATGAATATTTGGACACTGTCGAC
>probe:Drosophila_2:1638603_at:154:559; Interrogation_Position=274; Antisense; GGACACTGTCGACACTGAAAGCGGT
>probe:Drosophila_2:1638603_at:147:393; Interrogation_Position=290; Antisense; GAAAGCGGTCGTTCTCTCGAAGAAG
>probe:Drosophila_2:1638603_at:352:267; Interrogation_Position=409; Antisense; CAGGGATTCAACTATTATAAGGGAC
>probe:Drosophila_2:1638603_at:457:213; Interrogation_Position=453; Antisense; AAGTAGACGCTTTTGAAGGTTCGAT
>probe:Drosophila_2:1638603_at:652:163; Interrogation_Position=66; Antisense; AAATAAGATTCTTGGTGCTGTCACC
>probe:Drosophila_2:1638603_at:28:509; Interrogation_Position=80; Antisense; GTGCTGTCACCATCACCAACAAAAA

Paste this into a BLAST search page for me
TCGTTTTCCAATACTAACAAATCGGGGAACTTCAGAACCAACTACGAGTAGAAAGTGAGGTTCGATCTTAACATAAAAGAATTTTCTTCAATGGCGGATGATGGCGGATGAGCTAAATCACTTAACTTAATTGATGGCACTACTCCCAGCACTACTCCCAGCCATATTGAGACTTTTATGAATATTTGGACACTGTCGACGGACACTGTCGACACTGAAAGCGGTGAAAGCGGTCGTTCTCTCGAAGAAGCAGGGATTCAACTATTATAAGGGACAAGTAGACGCTTTTGAAGGTTCGATAAATAAGATTCTTGGTGCTGTCACCGTGCTGTCACCATCACCAACAAAAA

Full Affymetrix probeset data:

Annotations for 1638603_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720