Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638604_at:

>probe:Drosophila_2:1638604_at:59:69; Interrogation_Position=106; Antisense; ATGGCCGCTAAACTGGAGGACGCAA
>probe:Drosophila_2:1638604_at:238:697; Interrogation_Position=131; Antisense; TTTACGGCGACTTGAACGGCTGCAA
>probe:Drosophila_2:1638604_at:258:165; Interrogation_Position=168; Antisense; AAATCGCATACGTTCGCGTTTGGCC
>probe:Drosophila_2:1638604_at:605:189; Interrogation_Position=193; Antisense; AACTTGCGCGATCCGAAGAATCCAG
>probe:Drosophila_2:1638604_at:36:119; Interrogation_Position=218; Antisense; AGCTGCGCCAGAAGTTCCTATTAGG
>probe:Drosophila_2:1638604_at:668:163; Interrogation_Position=23; Antisense; AAATACGCATCAAGTGCCGCGAGAT
>probe:Drosophila_2:1638604_at:174:691; Interrogation_Position=238; Antisense; TTAGGTCAAATAACGCCCGAAGAGT
>probe:Drosophila_2:1638604_at:605:429; Interrogation_Position=259; Antisense; GAGTTATCCAAGATGACGCCCGAGG
>probe:Drosophila_2:1638604_at:453:349; Interrogation_Position=306; Antisense; GCAGATGCGCCAGAAGTACGTTCAG
>probe:Drosophila_2:1638604_at:250:489; Interrogation_Position=321; Antisense; GTACGTTCAGGACTCGATCAATGCG
>probe:Drosophila_2:1638604_at:312:473; Interrogation_Position=361; Antisense; GTTCAGGGCACCAAGACGGATCAGT
>probe:Drosophila_2:1638604_at:517:143; Interrogation_Position=413; Antisense; ACTGCAGCCAATTGCATATCCGTGA
>probe:Drosophila_2:1638604_at:127:23; Interrogation_Position=428; Antisense; ATATCCGTGATGGTGACGAGCCCAT
>probe:Drosophila_2:1638604_at:388:135; Interrogation_Position=443; Antisense; ACGAGCCCATTATCACCTTTGTGAT

Paste this into a BLAST search page for me
ATGGCCGCTAAACTGGAGGACGCAATTTACGGCGACTTGAACGGCTGCAAAAATCGCATACGTTCGCGTTTGGCCAACTTGCGCGATCCGAAGAATCCAGAGCTGCGCCAGAAGTTCCTATTAGGAAATACGCATCAAGTGCCGCGAGATTTAGGTCAAATAACGCCCGAAGAGTGAGTTATCCAAGATGACGCCCGAGGGCAGATGCGCCAGAAGTACGTTCAGGTACGTTCAGGACTCGATCAATGCGGTTCAGGGCACCAAGACGGATCAGTACTGCAGCCAATTGCATATCCGTGAATATCCGTGATGGTGACGAGCCCATACGAGCCCATTATCACCTTTGTGAT

Full Affymetrix probeset data:

Annotations for 1638604_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime