Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638605_at:

>probe:Drosophila_2:1638605_at:649:267; Interrogation_Position=1357; Antisense; CAGGACTATCTGGATTTCTTTCATT
>probe:Drosophila_2:1638605_at:196:231; Interrogation_Position=1396; Antisense; AATGACGTGGATACTGCCCTTACTT
>probe:Drosophila_2:1638605_at:292:639; Interrogation_Position=1415; Antisense; TTACTTTCTACCACATTGCGGGTGC
>probe:Drosophila_2:1638605_at:690:329; Interrogation_Position=1432; Antisense; GCGGGTGCCTCGATTGACCAACAAA
>probe:Drosophila_2:1638605_at:195:177; Interrogation_Position=1475; Antisense; AAACGGTGGCCATGGTCAATCTTTC
>probe:Drosophila_2:1638605_at:648:547; Interrogation_Position=1512; Antisense; GGATGTGGTCTTTACCATCTTTGAT
>probe:Drosophila_2:1638605_at:300:623; Interrogation_Position=1643; Antisense; TGCGATCGGTGTTCAAGTGCGCCAA
>probe:Drosophila_2:1638605_at:341:205; Interrogation_Position=1675; Antisense; AAGCCTGTGCTGCTGGACATCTAAA
>probe:Drosophila_2:1638605_at:491:451; Interrogation_Position=1700; Antisense; GATCGTCACTATGTGGATTCTCCCG
>probe:Drosophila_2:1638605_at:364:237; Interrogation_Position=1738; Antisense; AATCTTAGTCACTTTTTCCTACGCT
>probe:Drosophila_2:1638605_at:605:715; Interrogation_Position=1753; Antisense; TTCCTACGCTTACGCTTTTTACTAT
>probe:Drosophila_2:1638605_at:370:349; Interrogation_Position=1844; Antisense; GCAGGTTGACGACTGTCTTCTGTAT
>probe:Drosophila_2:1638605_at:318:715; Interrogation_Position=1861; Antisense; TTCTGTATATTTCACCGTCTCTTGT
>probe:Drosophila_2:1638605_at:588:497; Interrogation_Position=1877; Antisense; GTCTCTTGTGCACTTAACTCGTTTA

Paste this into a BLAST search page for me
CAGGACTATCTGGATTTCTTTCATTAATGACGTGGATACTGCCCTTACTTTTACTTTCTACCACATTGCGGGTGCGCGGGTGCCTCGATTGACCAACAAAAAACGGTGGCCATGGTCAATCTTTCGGATGTGGTCTTTACCATCTTTGATTGCGATCGGTGTTCAAGTGCGCCAAAAGCCTGTGCTGCTGGACATCTAAAGATCGTCACTATGTGGATTCTCCCGAATCTTAGTCACTTTTTCCTACGCTTTCCTACGCTTACGCTTTTTACTATGCAGGTTGACGACTGTCTTCTGTATTTCTGTATATTTCACCGTCTCTTGTGTCTCTTGTGCACTTAACTCGTTTA

Full Affymetrix probeset data:

Annotations for 1638605_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime