Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638610_at:

>probe:Drosophila_2:1638610_at:186:409; Interrogation_Position=2468; Antisense; GACGTCTAAGCTTCACAAGGTGCAA
>probe:Drosophila_2:1638610_at:190:241; Interrogation_Position=2545; Antisense; AATACCCGTCGTCCTGATACAACAT
>probe:Drosophila_2:1638610_at:433:151; Interrogation_Position=2566; Antisense; ACATCCGCTATATTTGCCTTATCTA
>probe:Drosophila_2:1638610_at:268:625; Interrogation_Position=2580; Antisense; TGCCTTATCTAGTCAGTGCACGATT
>probe:Drosophila_2:1638610_at:108:239; Interrogation_Position=2635; Antisense; AATCTGCGTGTCTTGCACGGTGGAA
>probe:Drosophila_2:1638610_at:532:711; Interrogation_Position=2660; Antisense; TTCAGATTGCTTGCATGGCAGCCAC
>probe:Drosophila_2:1638610_at:59:355; Interrogation_Position=2677; Antisense; GCAGCCACGGTGTTTTTGGGTTTGA
>probe:Drosophila_2:1638610_at:592:543; Interrogation_Position=2715; Antisense; GGATCACGTTCCCTACTTGCAAAGG
>probe:Drosophila_2:1638610_at:241:409; Interrogation_Position=2746; Antisense; GACGACAGCCCGTGGGTTCCTTGAA
>probe:Drosophila_2:1638610_at:532:721; Interrogation_Position=2766; Antisense; TTGAACTCCTTTTGCGACTTCGGAA
>probe:Drosophila_2:1638610_at:708:483; Interrogation_Position=2872; Antisense; GTATCGAATGCGACTATCCTAATTA
>probe:Drosophila_2:1638610_at:180:115; Interrogation_Position=2926; Antisense; AGCAGTTTGCTGTTCGCATTTTCCC
>probe:Drosophila_2:1638610_at:248:635; Interrogation_Position=2939; Antisense; TCGCATTTTCCCTCTAATTGTACGG
>probe:Drosophila_2:1638610_at:238:597; Interrogation_Position=2956; Antisense; TTGTACGGAACGAACTCATCTTATT

Paste this into a BLAST search page for me
GACGTCTAAGCTTCACAAGGTGCAAAATACCCGTCGTCCTGATACAACATACATCCGCTATATTTGCCTTATCTATGCCTTATCTAGTCAGTGCACGATTAATCTGCGTGTCTTGCACGGTGGAATTCAGATTGCTTGCATGGCAGCCACGCAGCCACGGTGTTTTTGGGTTTGAGGATCACGTTCCCTACTTGCAAAGGGACGACAGCCCGTGGGTTCCTTGAATTGAACTCCTTTTGCGACTTCGGAAGTATCGAATGCGACTATCCTAATTAAGCAGTTTGCTGTTCGCATTTTCCCTCGCATTTTCCCTCTAATTGTACGGTTGTACGGAACGAACTCATCTTATT

Full Affymetrix probeset data:

Annotations for 1638610_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime