FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638612_at:

>probe:Drosophila_2:1638612_at:512:307; Interrogation_Position=423; Antisense; CCACCAGTTCGGATACTATCGCATG
>probe:Drosophila_2:1638612_at:99:685; Interrogation_Position=439; Antisense; TATCGCATGGGTGATGCCAGCCATT
>probe:Drosophila_2:1638612_at:297:235; Interrogation_Position=532; Antisense; AATCCGGCCACCTACAAGTGCGATT
>probe:Drosophila_2:1638612_at:61:327; Interrogation_Position=641; Antisense; GCGAGCAGGAGGCTGACTACACCTT
>probe:Drosophila_2:1638612_at:292:397; Interrogation_Position=679; Antisense; GACAATTGCCAGGTGTACTTCATCT
>probe:Drosophila_2:1638612_at:276:711; Interrogation_Position=697; Antisense; TTCATCTGTATCGAGGGACGTCCGC
>probe:Drosophila_2:1638612_at:326:327; Interrogation_Position=737; Antisense; GCGAGGACCAGGCTTTCAACCAGGA
>probe:Drosophila_2:1638612_at:106:419; Interrogation_Position=760; Antisense; GAGCTGAACCAGTGCGACGACATCG
>probe:Drosophila_2:1638612_at:213:285; Interrogation_Position=798; Antisense; CTGCAGCAGTGCCATCCGTGAAAAG
>probe:Drosophila_2:1638612_at:371:223; Interrogation_Position=820; Antisense; AAGGGTGCCCAAATCAAGGCTGCTC
>probe:Drosophila_2:1638612_at:3:49; Interrogation_Position=872; Antisense; ATCCAGTTGTGATTTTTCCCATGCA
>probe:Drosophila_2:1638612_at:716:717; Interrogation_Position=887; Antisense; TTCCCATGCACATGCCATATGGCGA
>probe:Drosophila_2:1638612_at:58:469; Interrogation_Position=915; Antisense; GTTGCTCGAGTTTTCTAGTCTGTAG
>probe:Drosophila_2:1638612_at:97:461; Interrogation_Position=959; Antisense; GATTGTTGACATTTTGCGCGTCGAA

Paste this into a BLAST search page for me
CCACCAGTTCGGATACTATCGCATGTATCGCATGGGTGATGCCAGCCATTAATCCGGCCACCTACAAGTGCGATTGCGAGCAGGAGGCTGACTACACCTTGACAATTGCCAGGTGTACTTCATCTTTCATCTGTATCGAGGGACGTCCGCGCGAGGACCAGGCTTTCAACCAGGAGAGCTGAACCAGTGCGACGACATCGCTGCAGCAGTGCCATCCGTGAAAAGAAGGGTGCCCAAATCAAGGCTGCTCATCCAGTTGTGATTTTTCCCATGCATTCCCATGCACATGCCATATGGCGAGTTGCTCGAGTTTTCTAGTCTGTAGGATTGTTGACATTTTGCGCGTCGAA

Full Affymetrix probeset data:

Annotations for 1638612_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720