FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638613_at:

>probe:Drosophila_2:1638613_at:627:305; Interrogation_Position=230; Antisense; CCTCGACTCAAGTGTCTTGTGCTTA
>probe:Drosophila_2:1638613_at:328:309; Interrogation_Position=274; Antisense; CCAGGTCTGCGGAGAGTTGGCAACT
>probe:Drosophila_2:1638613_at:693:195; Interrogation_Position=295; Antisense; AACTGTGCGGGCAGTCTTATCACCG
>probe:Drosophila_2:1638613_at:327:267; Interrogation_Position=325; Antisense; CAGTCGTCGCTCGTGGTGCACTGAG
>probe:Drosophila_2:1638613_at:8:609; Interrogation_Position=346; Antisense; TGAGGGCACTCCAAGTCCAAGGACG
>probe:Drosophila_2:1638613_at:674:203; Interrogation_Position=456; Antisense; AAGCCGCTTTGTGCACGCATGGTAA
>probe:Drosophila_2:1638613_at:614:165; Interrogation_Position=486; Antisense; AAATCGGACTAAGCCACAGCTGCTG
>probe:Drosophila_2:1638613_at:93:157; Interrogation_Position=501; Antisense; ACAGCTGCTGCTTTAAATTCTTTGG
>probe:Drosophila_2:1638613_at:683:695; Interrogation_Position=512; Antisense; TTTAAATTCTTTGGGCCGTCTGGCT
>probe:Drosophila_2:1638613_at:109:305; Interrogation_Position=527; Antisense; CCGTCTGGCTGGCACACTGAGAGAA
>probe:Drosophila_2:1638613_at:335:609; Interrogation_Position=544; Antisense; TGAGAGAAAGTCTAGCCCCGTCGCA
>probe:Drosophila_2:1638613_at:537:237; Interrogation_Position=586; Antisense; AATCAATTGCTTGGCCTAGAATCTA
>probe:Drosophila_2:1638613_at:265:199; Interrogation_Position=614; Antisense; AACGATCTCTCAGTGTGTGACTTGT
>probe:Drosophila_2:1638613_at:563:97; Interrogation_Position=81; Antisense; AGATCCGCTTAGGTTTTCAGTTCGT

Paste this into a BLAST search page for me
CCTCGACTCAAGTGTCTTGTGCTTACCAGGTCTGCGGAGAGTTGGCAACTAACTGTGCGGGCAGTCTTATCACCGCAGTCGTCGCTCGTGGTGCACTGAGTGAGGGCACTCCAAGTCCAAGGACGAAGCCGCTTTGTGCACGCATGGTAAAAATCGGACTAAGCCACAGCTGCTGACAGCTGCTGCTTTAAATTCTTTGGTTTAAATTCTTTGGGCCGTCTGGCTCCGTCTGGCTGGCACACTGAGAGAATGAGAGAAAGTCTAGCCCCGTCGCAAATCAATTGCTTGGCCTAGAATCTAAACGATCTCTCAGTGTGTGACTTGTAGATCCGCTTAGGTTTTCAGTTCGT

Full Affymetrix probeset data:

Annotations for 1638613_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720