FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638614_at:

>probe:Drosophila_2:1638614_at:325:647; Interrogation_Position=3802; Antisense; TCAGTGTCCTTTGCCAGGATCTCAT
>probe:Drosophila_2:1638614_at:17:545; Interrogation_Position=3818; Antisense; GGATCTCATCCAGGCCGTCGTTGGC
>probe:Drosophila_2:1638614_at:6:49; Interrogation_Position=3825; Antisense; ATCCAGGCCGTCGTTGGCTATCGGG
>probe:Drosophila_2:1638614_at:638:285; Interrogation_Position=3957; Antisense; CTGGCCGTGAAGAGAGTCGCACCCT
>probe:Drosophila_2:1638614_at:201:97; Interrogation_Position=4045; Antisense; AGATCAAGGTCCACATAGTGCGCGT
>probe:Drosophila_2:1638614_at:460:25; Interrogation_Position=4059; Antisense; ATAGTGCGCGTGTGCCATGAACTGA
>probe:Drosophila_2:1638614_at:70:517; Interrogation_Position=4068; Antisense; GTGTGCCATGAACTGATCGGTATTT
>probe:Drosophila_2:1638614_at:491:41; Interrogation_Position=4083; Antisense; ATCGGTATTTGCGATCACCGTGCCG
>probe:Drosophila_2:1638614_at:179:695; Interrogation_Position=4090; Antisense; TTTGCGATCACCGTGCCGGACACTT
>probe:Drosophila_2:1638614_at:569:713; Interrogation_Position=4113; Antisense; TTCATCCTACGCTCCAGCAATGAGG
>probe:Drosophila_2:1638614_at:64:337; Interrogation_Position=4123; Antisense; GCTCCAGCAATGAGGCCGGCGCCAG
>probe:Drosophila_2:1638614_at:328:303; Interrogation_Position=4138; Antisense; CCGGCGCCAGGATGTACGAAGGATT
>probe:Drosophila_2:1638614_at:195:545; Interrogation_Position=4169; Antisense; GGATCACGAGAAGTACCACAAATTT
>probe:Drosophila_2:1638614_at:513:421; Interrogation_Position=4212; Antisense; GAGACAAGGAACGAGTACACCTGTA

Paste this into a BLAST search page for me
TCAGTGTCCTTTGCCAGGATCTCATGGATCTCATCCAGGCCGTCGTTGGCATCCAGGCCGTCGTTGGCTATCGGGCTGGCCGTGAAGAGAGTCGCACCCTAGATCAAGGTCCACATAGTGCGCGTATAGTGCGCGTGTGCCATGAACTGAGTGTGCCATGAACTGATCGGTATTTATCGGTATTTGCGATCACCGTGCCGTTTGCGATCACCGTGCCGGACACTTTTCATCCTACGCTCCAGCAATGAGGGCTCCAGCAATGAGGCCGGCGCCAGCCGGCGCCAGGATGTACGAAGGATTGGATCACGAGAAGTACCACAAATTTGAGACAAGGAACGAGTACACCTGTA

Full Affymetrix probeset data:

Annotations for 1638614_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720