Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638615_s_at:

>probe:Drosophila_2:1638615_s_at:505:301; Interrogation_Position=256; Antisense; CCCGCGAGATCGAGTTCGGCAGCAA
>probe:Drosophila_2:1638615_s_at:83:211; Interrogation_Position=279; Antisense; AAGAAGGCCGTCATCATCTACGTGC
>probe:Drosophila_2:1638615_s_at:317:507; Interrogation_Position=300; Antisense; GTGCCCATTCCACAGCAGAAGGTGT
>probe:Drosophila_2:1638615_s_at:12:535; Interrogation_Position=320; Antisense; GGTGTTCCAGAAGATCCAGATCATC
>probe:Drosophila_2:1638615_s_at:316:97; Interrogation_Position=337; Antisense; AGATCATCCTGGTCCGCGAGCTGGA
>probe:Drosophila_2:1638615_s_at:346:217; Interrogation_Position=366; Antisense; AAGTTCTCGGGCAAGCACGTCGTCG
>probe:Drosophila_2:1638615_s_at:379:329; Interrogation_Position=396; Antisense; GCGGAGCGCAAGATCCTGCCCAAGC
>probe:Drosophila_2:1638615_s_at:500:209; Interrogation_Position=447; Antisense; AAGCAGAAGCGTCCACGCTCCAGGA
>probe:Drosophila_2:1638615_s_at:186:309; Interrogation_Position=466; Antisense; CCAGGACTCTGACCGCTGTGTACGA
>probe:Drosophila_2:1638615_s_at:12:597; Interrogation_Position=482; Antisense; TGTGTACGACGCCATCCTTGAGGAT
>probe:Drosophila_2:1638615_s_at:186:299; Interrogation_Position=518; Antisense; CGCCGAGATTGTGGGCAAGCGCATC
>probe:Drosophila_2:1638615_s_at:644:583; Interrogation_Position=553; Antisense; TGGACGGCTCCCAGCTGGTCAAGGT
>probe:Drosophila_2:1638615_s_at:98:121; Interrogation_Position=565; Antisense; AGCTGGTCAAGGTGCACCTGGACAA
>probe:Drosophila_2:1638615_s_at:467:559; Interrogation_Position=584; Antisense; GGACAAGAACCAGCAGACCACCATT

Paste this into a BLAST search page for me
CCCGCGAGATCGAGTTCGGCAGCAAAAGAAGGCCGTCATCATCTACGTGCGTGCCCATTCCACAGCAGAAGGTGTGGTGTTCCAGAAGATCCAGATCATCAGATCATCCTGGTCCGCGAGCTGGAAAGTTCTCGGGCAAGCACGTCGTCGGCGGAGCGCAAGATCCTGCCCAAGCAAGCAGAAGCGTCCACGCTCCAGGACCAGGACTCTGACCGCTGTGTACGATGTGTACGACGCCATCCTTGAGGATCGCCGAGATTGTGGGCAAGCGCATCTGGACGGCTCCCAGCTGGTCAAGGTAGCTGGTCAAGGTGCACCTGGACAAGGACAAGAACCAGCAGACCACCATT

Full Affymetrix probeset data:

Annotations for 1638615_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime