Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638616_at:

>probe:Drosophila_2:1638616_at:47:457; Interrogation_Position=1559; Antisense; GATACTCAGTACATATTGGGCACTC
>probe:Drosophila_2:1638616_at:493:345; Interrogation_Position=1603; Antisense; GCATTTCTATGCCTTTAGCGCTTAC
>probe:Drosophila_2:1638616_at:608:665; Interrogation_Position=1625; Antisense; TACATAGTGGGCGTGTTTGCGGTCT
>probe:Drosophila_2:1638616_at:487:425; Interrogation_Position=1689; Antisense; GAGAGCATTTCTTCATCATTGACTT
>probe:Drosophila_2:1638616_at:239:521; Interrogation_Position=1719; Antisense; GTGGAATTTGCATTCTGGGCCTGGC
>probe:Drosophila_2:1638616_at:715:287; Interrogation_Position=1739; Antisense; CTGGCCATAGCTGGTTTTATTCTGC
>probe:Drosophila_2:1638616_at:293:477; Interrogation_Position=1752; Antisense; GTTTTATTCTGCTCCTTGGCAAGAA
>probe:Drosophila_2:1638616_at:452:615; Interrogation_Position=1779; Antisense; TGCACGTCAAATCCTGGTGGGCCAT
>probe:Drosophila_2:1638616_at:693:231; Interrogation_Position=1841; Antisense; AATGCTCGCGTATACAAGTTCGATG
>probe:Drosophila_2:1638616_at:23:663; Interrogation_Position=1878; Antisense; TAAAATCTTCAGACTCTCCCTACAA
>probe:Drosophila_2:1638616_at:693:277; Interrogation_Position=1897; Antisense; CTACAAGCCGACAGTGACATCACTT
>probe:Drosophila_2:1638616_at:433:7; Interrogation_Position=1939; Antisense; ATTGCTCATCTGTGAACTCTGGTAT
>probe:Drosophila_2:1638616_at:66:367; Interrogation_Position=1977; Antisense; GAATCATTTAGTCTGTCGCACACGG
>probe:Drosophila_2:1638616_at:390:655; Interrogation_Position=2015; Antisense; TAATAGTGCCTCAGTACTCTAGCAT

Paste this into a BLAST search page for me
GATACTCAGTACATATTGGGCACTCGCATTTCTATGCCTTTAGCGCTTACTACATAGTGGGCGTGTTTGCGGTCTGAGAGCATTTCTTCATCATTGACTTGTGGAATTTGCATTCTGGGCCTGGCCTGGCCATAGCTGGTTTTATTCTGCGTTTTATTCTGCTCCTTGGCAAGAATGCACGTCAAATCCTGGTGGGCCATAATGCTCGCGTATACAAGTTCGATGTAAAATCTTCAGACTCTCCCTACAACTACAAGCCGACAGTGACATCACTTATTGCTCATCTGTGAACTCTGGTATGAATCATTTAGTCTGTCGCACACGGTAATAGTGCCTCAGTACTCTAGCAT

Full Affymetrix probeset data:

Annotations for 1638616_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime