FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638617_at:

>probe:Drosophila_2:1638617_at:503:167; Interrogation_Position=271; Antisense; AAATGCTTCCACGATTTCTGCGAAT
>probe:Drosophila_2:1638617_at:493:77; Interrogation_Position=311; Antisense; AGGATGCCGTCGTCTTCAAGTTTAC
>probe:Drosophila_2:1638617_at:16:251; Interrogation_Position=327; Antisense; CAAGTTTACGAACTTCGCCTGTCTA
>probe:Drosophila_2:1638617_at:5:719; Interrogation_Position=340; Antisense; TTCGCCTGTCTAAGTCGCAATCAAT
>probe:Drosophila_2:1638617_at:719:31; Interrogation_Position=359; Antisense; ATCAATCCTGGTTTGTGTTCCACAA
>probe:Drosophila_2:1638617_at:667:255; Interrogation_Position=379; Antisense; CACAATTGTCGTCTGAAGGCGGTCA
>probe:Drosophila_2:1638617_at:713:65; Interrogation_Position=431; Antisense; ATGGAACGGTTCTACATCCGGCCAA
>probe:Drosophila_2:1638617_at:377:53; Interrogation_Position=530; Antisense; ATGCTTGTCGCTTTGTGCGGACCAA
>probe:Drosophila_2:1638617_at:620:189; Interrogation_Position=553; Antisense; AACTTCCATCCGTTTGTACGCATTA
>probe:Drosophila_2:1638617_at:145:489; Interrogation_Position=568; Antisense; GTACGCATTATATTCGATCTCTTCA
>probe:Drosophila_2:1638617_at:717:451; Interrogation_Position=583; Antisense; GATCTCTTCAAAGATTTCTCCACCA
>probe:Drosophila_2:1638617_at:536:139; Interrogation_Position=616; Antisense; ACGTGCCCATATGTGGCCCGAGAAA
>probe:Drosophila_2:1638617_at:158:615; Interrogation_Position=642; Antisense; TGAAGCTGCCATTTCCATCTGGAGA
>probe:Drosophila_2:1638617_at:681:253; Interrogation_Position=697; Antisense; CAAAAGGCCACAGTTCGATACGAAT

Paste this into a BLAST search page for me
AAATGCTTCCACGATTTCTGCGAATAGGATGCCGTCGTCTTCAAGTTTACCAAGTTTACGAACTTCGCCTGTCTATTCGCCTGTCTAAGTCGCAATCAATATCAATCCTGGTTTGTGTTCCACAACACAATTGTCGTCTGAAGGCGGTCAATGGAACGGTTCTACATCCGGCCAAATGCTTGTCGCTTTGTGCGGACCAAAACTTCCATCCGTTTGTACGCATTAGTACGCATTATATTCGATCTCTTCAGATCTCTTCAAAGATTTCTCCACCAACGTGCCCATATGTGGCCCGAGAAATGAAGCTGCCATTTCCATCTGGAGACAAAAGGCCACAGTTCGATACGAAT

Full Affymetrix probeset data:

Annotations for 1638617_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720