Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638619_s_at:

>probe:Drosophila_2:1638619_s_at:134:685; Interrogation_Position=1013; Antisense; TATAGCCCTTATAGTACTCCTTTCA
>probe:Drosophila_2:1638619_s_at:390:23; Interrogation_Position=1023; Antisense; ATAGTACTCCTTTCAGTAGTCCTCG
>probe:Drosophila_2:1638619_s_at:471:83; Interrogation_Position=1037; Antisense; AGTAGTCCTCGATCTAGTCGACGGA
>probe:Drosophila_2:1638619_s_at:199:35; Interrogation_Position=1048; Antisense; ATCTAGTCGACGGAAACCAGCTTTT
>probe:Drosophila_2:1638619_s_at:582:391; Interrogation_Position=1060; Antisense; GAAACCAGCTTTTCGGGAGTCTAGA
>probe:Drosophila_2:1638619_s_at:645:273; Interrogation_Position=770; Antisense; CATTCTCTGGAATTGTGCACTGATA
>probe:Drosophila_2:1638619_s_at:226:389; Interrogation_Position=818; Antisense; GAAAACTTTTGTACTGATATCCATA
>probe:Drosophila_2:1638619_s_at:76:273; Interrogation_Position=839; Antisense; CATAAATGCGTAGTCGATTCCGAAT
>probe:Drosophila_2:1638619_s_at:286:719; Interrogation_Position=856; Antisense; TTCCGAATCGAATAAGCCAAACAAA
>probe:Drosophila_2:1638619_s_at:144:491; Interrogation_Position=924; Antisense; GTAAAGTTTCTAATGAACCACCTCA
>probe:Drosophila_2:1638619_s_at:59:381; Interrogation_Position=938; Antisense; GAACCACCTCAACATAATACGGCAT
>probe:Drosophila_2:1638619_s_at:297:27; Interrogation_Position=954; Antisense; ATACGGCATCAAAACCTCAAATCTT
>probe:Drosophila_2:1638619_s_at:274:687; Interrogation_Position=978; Antisense; TATATGAGACTCGTCCTATCTACCC
>probe:Drosophila_2:1638619_s_at:471:671; Interrogation_Position=998; Antisense; TACCCGAATGTACCGTATAGCCCTT

Paste this into a BLAST search page for me
TATAGCCCTTATAGTACTCCTTTCAATAGTACTCCTTTCAGTAGTCCTCGAGTAGTCCTCGATCTAGTCGACGGAATCTAGTCGACGGAAACCAGCTTTTGAAACCAGCTTTTCGGGAGTCTAGACATTCTCTGGAATTGTGCACTGATAGAAAACTTTTGTACTGATATCCATACATAAATGCGTAGTCGATTCCGAATTTCCGAATCGAATAAGCCAAACAAAGTAAAGTTTCTAATGAACCACCTCAGAACCACCTCAACATAATACGGCATATACGGCATCAAAACCTCAAATCTTTATATGAGACTCGTCCTATCTACCCTACCCGAATGTACCGTATAGCCCTT

Full Affymetrix probeset data:

Annotations for 1638619_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime