FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638621_at:

>probe:Drosophila_2:1638621_at:226:49; Interrogation_Position=252; Antisense; ATGCCGCCCGTAAATTGCGTGCGAA
>probe:Drosophila_2:1638621_at:348:623; Interrogation_Position=271; Antisense; TGCGAAATCCACACTCTACTACATA
>probe:Drosophila_2:1638621_at:136:605; Interrogation_Position=312; Antisense; TGATTGTGGGCCTGAGCTATGCTGC
>probe:Drosophila_2:1638621_at:589:713; Interrogation_Position=356; Antisense; TTCTGCCAGGCCTACAGTTACGGAG
>probe:Drosophila_2:1638621_at:391:613; Interrogation_Position=447; Antisense; TGAAGATCCGTTTCAACGCCGACAT
>probe:Drosophila_2:1638621_at:477:47; Interrogation_Position=475; Antisense; ATCCTCGATGCGCTGGAACTTCAAG
>probe:Drosophila_2:1638621_at:502:171; Interrogation_Position=518; Antisense; AAAGTAGCTCCTGGCGAGACTGCTC
>probe:Drosophila_2:1638621_at:488:317; Interrogation_Position=577; Antisense; GCCGGTAATTGGCATCAGCACGTAC
>probe:Drosophila_2:1638621_at:134:491; Interrogation_Position=598; Antisense; GTACAATGTGATTCCCTTCGAGGCG
>probe:Drosophila_2:1638621_at:58:23; Interrogation_Position=618; Antisense; AGGCGGGCGCGTATTTCAACAAAAT
>probe:Drosophila_2:1638621_at:418:185; Interrogation_Position=638; Antisense; AAAATCCAATGCTTTTGCTTCGAGG
>probe:Drosophila_2:1638621_at:675:385; Interrogation_Position=662; Antisense; GAACAGCAACTGAATCCACACGAGG
>probe:Drosophila_2:1638621_at:634:163; Interrogation_Position=723; Antisense; AAATAACGGCAGATCCGGCGCTGGA
>probe:Drosophila_2:1638621_at:386:1; Interrogation_Position=795; Antisense; AGGGTCTGAAACTGAACTTCCCCAG

Paste this into a BLAST search page for me
ATGCCGCCCGTAAATTGCGTGCGAATGCGAAATCCACACTCTACTACATATGATTGTGGGCCTGAGCTATGCTGCTTCTGCCAGGCCTACAGTTACGGAGTGAAGATCCGTTTCAACGCCGACATATCCTCGATGCGCTGGAACTTCAAGAAAGTAGCTCCTGGCGAGACTGCTCGCCGGTAATTGGCATCAGCACGTACGTACAATGTGATTCCCTTCGAGGCGAGGCGGGCGCGTATTTCAACAAAATAAAATCCAATGCTTTTGCTTCGAGGGAACAGCAACTGAATCCACACGAGGAAATAACGGCAGATCCGGCGCTGGAAGGGTCTGAAACTGAACTTCCCCAG

Full Affymetrix probeset data:

Annotations for 1638621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720