FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638622_at:

>probe:Drosophila_2:1638622_at:435:413; Interrogation_Position=111; Antisense; GACCTTCCGGATAATTTCGATCTTT
>probe:Drosophila_2:1638622_at:513:637; Interrogation_Position=127; Antisense; TCGATCTTTCTGTATCTGGGCGGGA
>probe:Drosophila_2:1638622_at:67:69; Interrogation_Position=13; Antisense; ATGGCCTCGTCCACTTTGGATTTGG
>probe:Drosophila_2:1638622_at:261:527; Interrogation_Position=162; Antisense; GGGAATGGTGCTGGCCCTCTACTAT
>probe:Drosophila_2:1638622_at:177:643; Interrogation_Position=179; Antisense; TCTACTATCTCATGTTCTTCGACTC
>probe:Drosophila_2:1638622_at:627:59; Interrogation_Position=190; Antisense; ATGTTCTTCGACTCCAGCATGCCGG
>probe:Drosophila_2:1638622_at:371:115; Interrogation_Position=205; Antisense; AGCATGCCGGACATTCATCTCAAGT
>probe:Drosophila_2:1638622_at:188:551; Interrogation_Position=213; Antisense; GGACATTCATCTCAAGTTTCCCGTC
>probe:Drosophila_2:1638622_at:18:653; Interrogation_Position=224; Antisense; TCAAGTTTCCCGTCTCCATTGGCGG
>probe:Drosophila_2:1638622_at:88:275; Interrogation_Position=240; Antisense; CATTGGCGGCCATCCAGTGCAGAAG
>probe:Drosophila_2:1638622_at:385:613; Interrogation_Position=257; Antisense; TGCAGAAGGTGCACGAGTACCAGTG
>probe:Drosophila_2:1638622_at:454:561; Interrogation_Position=51; Antisense; GGAAAATGATGACGTGCGCCTGCCC
>probe:Drosophila_2:1638622_at:501:203; Interrogation_Position=86; Antisense; AACCACCAGCCTTCTTCGAATCGAA
>probe:Drosophila_2:1638622_at:40:17; Interrogation_Position=99; Antisense; CTTCGAATCGAAGACCTTCCGGATA

Paste this into a BLAST search page for me
GACCTTCCGGATAATTTCGATCTTTTCGATCTTTCTGTATCTGGGCGGGAATGGCCTCGTCCACTTTGGATTTGGGGGAATGGTGCTGGCCCTCTACTATTCTACTATCTCATGTTCTTCGACTCATGTTCTTCGACTCCAGCATGCCGGAGCATGCCGGACATTCATCTCAAGTGGACATTCATCTCAAGTTTCCCGTCTCAAGTTTCCCGTCTCCATTGGCGGCATTGGCGGCCATCCAGTGCAGAAGTGCAGAAGGTGCACGAGTACCAGTGGGAAAATGATGACGTGCGCCTGCCCAACCACCAGCCTTCTTCGAATCGAACTTCGAATCGAAGACCTTCCGGATA

Full Affymetrix probeset data:

Annotations for 1638622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720