FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638624_at:

>probe:Drosophila_2:1638624_at:354:585; Interrogation_Position=1044; Antisense; TGGAAAAGTCGTCACAGCGCTCTGC
>probe:Drosophila_2:1638624_at:232:263; Interrogation_Position=1058; Antisense; CAGCGCTCTGCTGAACTGGGAAAGA
>probe:Drosophila_2:1638624_at:310:223; Interrogation_Position=617; Antisense; AAGGTGATACGCACCATGCCCAATA
>probe:Drosophila_2:1638624_at:205:51; Interrogation_Position=632; Antisense; ATGCCCAATACATCCATGCAGGTGG
>probe:Drosophila_2:1638624_at:183:83; Interrogation_Position=660; Antisense; AGGGCTGCACTGTTTACACTGGCAA
>probe:Drosophila_2:1638624_at:464:135; Interrogation_Position=688; Antisense; ACGCGTTTCGCATCACGACTTGGAA
>probe:Drosophila_2:1638624_at:298:171; Interrogation_Position=712; Antisense; AAAGATTCACCTAATGCTCAACGCC
>probe:Drosophila_2:1638624_at:450:187; Interrogation_Position=750; Antisense; AACAGGTGCCCGAGTCCATGATCGA
>probe:Drosophila_2:1638624_at:226:505; Interrogation_Position=801; Antisense; GTCCGGCATTTGTTTACACCATCAT
>probe:Drosophila_2:1638624_at:286:651; Interrogation_Position=849; Antisense; TCAAACAGGGCGTTCCGCGTCAGAT
>probe:Drosophila_2:1638624_at:125:99; Interrogation_Position=870; Antisense; AGATGGCTCTTCAGTTTGCGGCTCA
>probe:Drosophila_2:1638624_at:447:101; Interrogation_Position=894; Antisense; AGACGCTTCTGGGAGCGGCCAAAAC
>probe:Drosophila_2:1638624_at:360:181; Interrogation_Position=914; Antisense; AAAACGGTGCTGCTCACTGGAAAAC
>probe:Drosophila_2:1638624_at:505:547; Interrogation_Position=955; Antisense; GGATGAAGTCTGTTCTCCCGGTGGC

Paste this into a BLAST search page for me
TGGAAAAGTCGTCACAGCGCTCTGCCAGCGCTCTGCTGAACTGGGAAAGAAAGGTGATACGCACCATGCCCAATAATGCCCAATACATCCATGCAGGTGGAGGGCTGCACTGTTTACACTGGCAAACGCGTTTCGCATCACGACTTGGAAAAAGATTCACCTAATGCTCAACGCCAACAGGTGCCCGAGTCCATGATCGAGTCCGGCATTTGTTTACACCATCATTCAAACAGGGCGTTCCGCGTCAGATAGATGGCTCTTCAGTTTGCGGCTCAAGACGCTTCTGGGAGCGGCCAAAACAAAACGGTGCTGCTCACTGGAAAACGGATGAAGTCTGTTCTCCCGGTGGC

Full Affymetrix probeset data:

Annotations for 1638624_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720